Incidental Mutation 'R4830:Slc22a15'
ID372727
Institutional Source Beutler Lab
Gene Symbol Slc22a15
Ensembl Gene ENSMUSG00000033147
Gene Namesolute carrier family 22 (organic anion/cation transporter), member 15
SynonymsA530052I06Rik, 2610034P21Rik
MMRRC Submission 042446-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4830 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location101855776-101924453 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 101875603 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106928] [ENSMUST00000183255] [ENSMUST00000190824]
Predicted Effect probably benign
Transcript: ENSMUST00000106928
SMART Domains Protein: ENSMUSP00000102541
Gene: ENSMUSG00000033147

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 58 495 6.9e-29 PFAM
Pfam:MFS_1 69 450 3.4e-24 PFAM
low complexity region 524 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183098
Predicted Effect probably benign
Transcript: ENSMUST00000183255
SMART Domains Protein: ENSMUSP00000138357
Gene: ENSMUSG00000033147

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 56 244 5.2e-13 PFAM
Pfam:MFS_1 69 244 7.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183293
Predicted Effect probably benign
Transcript: ENSMUST00000190824
SMART Domains Protein: ENSMUSP00000139518
Gene: ENSMUSG00000033147

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Pfam:Sugar_tr 88 341 3.3e-5 PFAM
low complexity region 369 377 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Organic ion transporters, such as SLC22A15, transport various medically and physiologically important compounds, including pharmaceuticals, toxins, hormones, neurotransmitters, and cellular metabolites. These transporters are also referred to as amphiphilic solute facilitators (ASFs).[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 C A 3: 121,760,284 G643V probably damaging Het
Adamtsl1 A G 4: 86,356,382 E1225G probably damaging Het
Agbl5 G A 5: 30,890,715 R111H probably damaging Het
Ankle2 A C 5: 110,242,013 K446Q probably damaging Het
Boc A C 16: 44,490,157 M800R probably damaging Het
Ccnt1 A T 15: 98,543,451 N645K probably damaging Het
Cd93 G A 2: 148,443,379 Q16* probably null Het
Cpsf4l G T 11: 113,709,502 probably benign Het
Cuzd1 T A 7: 131,318,054 D111V probably damaging Het
Dab2 T C 15: 6,427,527 C232R probably benign Het
Dmpk A T 7: 19,087,528 Y237F probably damaging Het
Dnah6 T A 6: 73,044,762 T3526S possibly damaging Het
Dock2 T C 11: 34,273,767 probably null Het
Dsp G A 13: 38,192,864 V1542I probably benign Het
Dst T A 1: 34,198,505 probably null Het
Esd T C 14: 74,741,160 L54S probably damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Gm3604 A T 13: 62,369,043 N500K probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grhl2 T A 15: 37,335,659 probably null Het
Gsto1 C T 19: 47,864,391 R222C probably benign Het
H2afy2 C T 10: 61,739,353 D355N possibly damaging Het
Inpp4a T A 1: 37,371,780 M343K probably damaging Het
Itpripl2 T C 7: 118,491,057 Q93R probably benign Het
Jakmip2 G A 18: 43,567,143 T450I probably benign Het
Kdm6b A T 11: 69,403,794 I1186N unknown Het
Kif1a T C 1: 93,021,209 probably null Het
Klhl20 T C 1: 161,098,376 K434R probably benign Het
Lemd3 T C 10: 120,931,948 D697G probably damaging Het
Lipo1 A G 19: 33,776,587 S383P probably damaging Het
Ltn1 C A 16: 87,379,694 K1741N probably damaging Het
Lvrn A T 18: 46,905,351 T991S probably damaging Het
Mast3 C A 8: 70,788,915 R151L possibly damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myoz1 T C 14: 20,655,309 K14E probably damaging Het
Neb G T 2: 52,192,520 Q5450K probably damaging Het
Nedd1 T A 10: 92,686,258 N639I probably damaging Het
Nlrp4e A T 7: 23,336,740 N673Y probably benign Het
Nop53 C T 7: 15,942,204 R190Q probably damaging Het
Notch4 T C 17: 34,570,118 Y468H probably damaging Het
Obscn T C 11: 59,067,607 T3507A probably damaging Het
Olfr724 T C 14: 49,960,224 N283D probably damaging Het
Opn5 T C 17: 42,611,296 H5R probably benign Het
Patl1 T C 19: 11,925,151 M349T probably benign Het
Phactr3 A G 2: 178,284,018 N362S probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Rapgef5 G A 12: 117,756,074 R579Q probably damaging Het
Rgl1 T C 1: 152,554,330 D234G probably benign Het
Serpinb3a C T 1: 107,048,586 E122K probably benign Het
Slc25a12 A T 2: 71,296,805 V344E probably damaging Het
Slc43a2 T C 11: 75,543,293 L99P probably damaging Het
Smim27 G T 4: 40,269,719 probably null Het
Smtn A G 11: 3,520,736 probably benign Het
Szt2 A T 4: 118,369,248 Y3001N unknown Het
Tgfbr3 G T 5: 107,109,719 P825T probably damaging Het
Tnpo3 T C 6: 29,568,938 T472A probably benign Het
Trf T A 9: 103,227,915 D66V probably damaging Het
Vmn1r124 A G 7: 21,259,699 C307R probably damaging Het
Vps13b T A 15: 35,452,224 F656Y possibly damaging Het
Zic1 G T 9: 91,362,531 S358R probably damaging Het
Other mutations in Slc22a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Slc22a15 APN 3 101860820 missense probably benign 0.00
IGL01120:Slc22a15 APN 3 101897166 missense probably damaging 1.00
IGL01345:Slc22a15 APN 3 101880176 missense probably benign 0.00
IGL01871:Slc22a15 APN 3 101860794 splice site probably benign
IGL01880:Slc22a15 APN 3 101860848 missense probably benign 0.32
R0310:Slc22a15 UTSW 3 101860511 missense probably benign 0.12
R1758:Slc22a15 UTSW 3 101860453 nonsense probably null
R1937:Slc22a15 UTSW 3 101880189 critical splice acceptor site probably null
R3804:Slc22a15 UTSW 3 101897274 missense probably damaging 1.00
R5564:Slc22a15 UTSW 3 101864589 missense probably benign 0.34
R5684:Slc22a15 UTSW 3 101862955 missense probably damaging 1.00
R6034:Slc22a15 UTSW 3 101862919 missense possibly damaging 0.80
R6034:Slc22a15 UTSW 3 101862919 missense possibly damaging 0.80
R6114:Slc22a15 UTSW 3 101860852 nonsense probably null
R6481:Slc22a15 UTSW 3 101883583 missense possibly damaging 0.88
R6641:Slc22a15 UTSW 3 101875706 missense possibly damaging 0.52
R6945:Slc22a15 UTSW 3 101924114 missense probably damaging 0.99
R7354:Slc22a15 UTSW 3 101864581 missense probably benign 0.09
R7373:Slc22a15 UTSW 3 101877897 missense possibly damaging 0.78
R7431:Slc22a15 UTSW 3 101897940 missense probably benign 0.13
R7758:Slc22a15 UTSW 3 101897935 critical splice donor site probably null
R8058:Slc22a15 UTSW 3 101864610 missense probably benign
R8129:Slc22a15 UTSW 3 101915342 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGTGCTGCATCCCAGATACC -3'
(R):5'- GACCAGCTACATTTGCCACC -3'

Sequencing Primer
(F):5'- GATACCCCAGATGGTAGCTTAATAGC -3'
(R):5'- GAGGGAAGATGGCTTTATAAGATTC -3'
Posted On2016-03-01