Incidental Mutation 'R4830:Abcd3'
ID372728
Institutional Source Beutler Lab
Gene Symbol Abcd3
Ensembl Gene ENSMUSG00000028127
Gene NameATP-binding cassette, sub-family D (ALD), member 3
SynonymsPMP70, Pxmp1
MMRRC Submission 042446-MU
Accession Numbers

Genbank: NM_008991; MGI: 1349216

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4830 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location121758774-121815302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 121760284 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 643 (G643V)
Ref Sequence ENSEMBL: ENSMUSP00000029770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029770] [ENSMUST00000197383] [ENSMUST00000197662]
Predicted Effect probably damaging
Transcript: ENSMUST00000029770
AA Change: G643V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029770
Gene: ENSMUSG00000028127
AA Change: G643V

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
Pfam:ABC_membrane_2 57 338 8.6e-106 PFAM
AAA 465 640 6.88e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196026
Predicted Effect unknown
Transcript: ENSMUST00000197383
AA Change: G533V
SMART Domains Protein: ENSMUSP00000142387
Gene: ENSMUSG00000028127
AA Change: G533V

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:ABC_membrane_2 57 277 2.3e-78 PFAM
AAA 355 530 1.1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197662
SMART Domains Protein: ENSMUSP00000143487
Gene: ENSMUSG00000028127

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199084
Meta Mutation Damage Score 0.7447 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. This peroxisomal membrane protein likely plays an important role in peroxisome biogenesis. Mutations have been associated with some forms of Zellweger syndrome, a heterogeneous group of peroxisome assembly disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show enlarged livers, abnormal bile composition and peroxisome abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A G 4: 86,356,382 E1225G probably damaging Het
Agbl5 G A 5: 30,890,715 R111H probably damaging Het
Ankle2 A C 5: 110,242,013 K446Q probably damaging Het
Boc A C 16: 44,490,157 M800R probably damaging Het
Ccnt1 A T 15: 98,543,451 N645K probably damaging Het
Cd93 G A 2: 148,443,379 Q16* probably null Het
Cpsf4l G T 11: 113,709,502 probably benign Het
Cuzd1 T A 7: 131,318,054 D111V probably damaging Het
Dab2 T C 15: 6,427,527 C232R probably benign Het
Dmpk A T 7: 19,087,528 Y237F probably damaging Het
Dnah6 T A 6: 73,044,762 T3526S possibly damaging Het
Dock2 T C 11: 34,273,767 probably null Het
Dsp G A 13: 38,192,864 V1542I probably benign Het
Dst T A 1: 34,198,505 probably null Het
Esd T C 14: 74,741,160 L54S probably damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Gm3604 A T 13: 62,369,043 N500K probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grhl2 T A 15: 37,335,659 probably null Het
Gsto1 C T 19: 47,864,391 R222C probably benign Het
H2afy2 C T 10: 61,739,353 D355N possibly damaging Het
Inpp4a T A 1: 37,371,780 M343K probably damaging Het
Itpripl2 T C 7: 118,491,057 Q93R probably benign Het
Jakmip2 G A 18: 43,567,143 T450I probably benign Het
Kdm6b A T 11: 69,403,794 I1186N unknown Het
Kif1a T C 1: 93,021,209 probably null Het
Klhl20 T C 1: 161,098,376 K434R probably benign Het
Lemd3 T C 10: 120,931,948 D697G probably damaging Het
Lipo1 A G 19: 33,776,587 S383P probably damaging Het
Ltn1 C A 16: 87,379,694 K1741N probably damaging Het
Lvrn A T 18: 46,905,351 T991S probably damaging Het
Mast3 C A 8: 70,788,915 R151L possibly damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myoz1 T C 14: 20,655,309 K14E probably damaging Het
Neb G T 2: 52,192,520 Q5450K probably damaging Het
Nedd1 T A 10: 92,686,258 N639I probably damaging Het
Nlrp4e A T 7: 23,336,740 N673Y probably benign Het
Nop53 C T 7: 15,942,204 R190Q probably damaging Het
Notch4 T C 17: 34,570,118 Y468H probably damaging Het
Obscn T C 11: 59,067,607 T3507A probably damaging Het
Olfr724 T C 14: 49,960,224 N283D probably damaging Het
Opn5 T C 17: 42,611,296 H5R probably benign Het
Patl1 T C 19: 11,925,151 M349T probably benign Het
Phactr3 A G 2: 178,284,018 N362S probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Rapgef5 G A 12: 117,756,074 R579Q probably damaging Het
Rgl1 T C 1: 152,554,330 D234G probably benign Het
Serpinb3a C T 1: 107,048,586 E122K probably benign Het
Slc22a15 T C 3: 101,875,603 probably benign Het
Slc25a12 A T 2: 71,296,805 V344E probably damaging Het
Slc43a2 T C 11: 75,543,293 L99P probably damaging Het
Smim27 G T 4: 40,269,719 probably null Het
Smtn A G 11: 3,520,736 probably benign Het
Szt2 A T 4: 118,369,248 Y3001N unknown Het
Tgfbr3 G T 5: 107,109,719 P825T probably damaging Het
Tnpo3 T C 6: 29,568,938 T472A probably benign Het
Trf T A 9: 103,227,915 D66V probably damaging Het
Vmn1r124 A G 7: 21,259,699 C307R probably damaging Het
Vps13b T A 15: 35,452,224 F656Y possibly damaging Het
Zic1 G T 9: 91,362,531 S358R probably damaging Het
Other mutations in Abcd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Abcd3 APN 3 121776993 splice site probably benign
IGL00670:Abcd3 APN 3 121775684 missense probably damaging 1.00
IGL02473:Abcd3 APN 3 121769244 missense possibly damaging 0.74
IGL02660:Abcd3 APN 3 121784020 missense probably damaging 1.00
IGL02993:Abcd3 APN 3 121774010 missense probably benign 0.01
IGL03131:Abcd3 APN 3 121781991 splice site probably benign
3-1:Abcd3 UTSW 3 121760300 missense probably benign
R0324:Abcd3 UTSW 3 121769167 missense probably null 0.00
R0599:Abcd3 UTSW 3 121765093 missense probably damaging 1.00
R0682:Abcd3 UTSW 3 121769567 missense possibly damaging 0.90
R1109:Abcd3 UTSW 3 121779596 missense probably damaging 1.00
R1453:Abcd3 UTSW 3 121765061 missense probably damaging 1.00
R1544:Abcd3 UTSW 3 121784473 missense probably benign 0.11
R1571:Abcd3 UTSW 3 121792842 missense possibly damaging 0.80
R1779:Abcd3 UTSW 3 121781963 missense probably damaging 1.00
R2429:Abcd3 UTSW 3 121792863 missense probably damaging 1.00
R4326:Abcd3 UTSW 3 121761470 missense probably benign 0.06
R4676:Abcd3 UTSW 3 121774166 missense possibly damaging 0.69
R4929:Abcd3 UTSW 3 121768746 splice site probably null
R4980:Abcd3 UTSW 3 121769268 splice site probably null
R5052:Abcd3 UTSW 3 121769513 critical splice donor site probably null
R5384:Abcd3 UTSW 3 121761410 splice site probably null
R5616:Abcd3 UTSW 3 121772360 missense probably benign 0.00
R5796:Abcd3 UTSW 3 121784498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCAATTTAATTCAGGCAGG -3'
(R):5'- TCTGAGCTGCAATTCAGAGC -3'

Sequencing Primer
(F):5'- GGCAGGTTTTTTAACCACA -3'
(R):5'- CTGCAATTCAGAGCTGTGAAAGC -3'
Posted On2016-03-01