Incidental Mutation 'R4830:Agbl5'
ID 372731
Institutional Source Beutler Lab
Gene Symbol Agbl5
Ensembl Gene ENSMUSG00000029165
Gene Name ATP/GTP binding protein-like 5
Synonyms Ccp5, 9430057O19Rik
MMRRC Submission 042446-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4830 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 31046038-31064309 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 31048059 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 111 (R111H)
Ref Sequence ENSEMBL: ENSMUSP00000144274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069705] [ENSMUST00000114700] [ENSMUST00000200695] [ENSMUST00000200850] [ENSMUST00000201168] [ENSMUST00000201225] [ENSMUST00000201817] [ENSMUST00000201917] [ENSMUST00000202060] [ENSMUST00000202109]
AlphaFold Q09M02
Predicted Effect probably damaging
Transcript: ENSMUST00000069705
AA Change: R111H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063228
Gene: ENSMUSG00000029165
AA Change: R111H

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 191 361 8.4e-19 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 4e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114700
AA Change: R111H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110348
Gene: ENSMUSG00000029165
AA Change: R111H

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 220 390 1.1e-18 PFAM
low complexity region 413 428 N/A INTRINSIC
Blast:Zn_pept 453 518 5e-14 BLAST
low complexity region 567 577 N/A INTRINSIC
low complexity region 672 683 N/A INTRINSIC
low complexity region 743 762 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
low complexity region 824 835 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124908
AA Change: R111H

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121389
Gene: ENSMUSG00000029165
AA Change: R111H

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
SCOP:d1jqga1 178 229 1e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148394
AA Change: R592H
Predicted Effect probably damaging
Transcript: ENSMUST00000200695
AA Change: R111H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144109
Gene: ENSMUSG00000029165
AA Change: R111H

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
SCOP:d2ctc__ 148 177 5e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200850
AA Change: R111H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144274
Gene: ENSMUSG00000029165
AA Change: R111H

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
SCOP:d1jqga1 178 229 1e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201167
Predicted Effect probably damaging
Transcript: ENSMUST00000201168
AA Change: R111H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143808
Gene: ENSMUSG00000029165
AA Change: R111H

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 370 7.3e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 836 847 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201225
AA Change: R111H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143934
Gene: ENSMUSG00000029165
AA Change: R111H

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201817
AA Change: R111H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144304
Gene: ENSMUSG00000029165
AA Change: R111H

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.4e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201917
AA Change: R111H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144188
Gene: ENSMUSG00000029165
AA Change: R111H

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.5e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 795 806 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201918
Predicted Effect probably damaging
Transcript: ENSMUST00000202060
AA Change: R111H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144018
Gene: ENSMUSG00000029165
AA Change: R111H

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202565
Predicted Effect probably benign
Transcript: ENSMUST00000202109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202757
Meta Mutation Damage Score 0.2163 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metallocarboxypeptidase involved in protein deglutamylation and a member of the peptidase M14 family of proteins. The encoded protein has been described as a "dual-functional" deglutamylase that can remove glutamate residues from both carboxyl termini and side chains of protein substrates. This deglutamylase activity may be important in antiviral immunity. Mutations in this gene are associated with retinitis pigmentosa. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to HSV or VACV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 C A 3: 121,553,933 (GRCm39) G643V probably damaging Het
Adamtsl1 A G 4: 86,274,619 (GRCm39) E1225G probably damaging Het
Ankle2 A C 5: 110,389,879 (GRCm39) K446Q probably damaging Het
Boc A C 16: 44,310,520 (GRCm39) M800R probably damaging Het
Ccnt1 A T 15: 98,441,332 (GRCm39) N645K probably damaging Het
Cd93 G A 2: 148,285,299 (GRCm39) Q16* probably null Het
Cpsf4l G T 11: 113,600,328 (GRCm39) probably benign Het
Cuzd1 T A 7: 130,919,783 (GRCm39) D111V probably damaging Het
Dab2 T C 15: 6,457,008 (GRCm39) C232R probably benign Het
Dmpk A T 7: 18,821,453 (GRCm39) Y237F probably damaging Het
Dnah6 T A 6: 73,021,745 (GRCm39) T3526S possibly damaging Het
Dock2 T C 11: 34,223,767 (GRCm39) probably null Het
Dsp G A 13: 38,376,840 (GRCm39) V1542I probably benign Het
Dst T A 1: 34,237,586 (GRCm39) probably null Het
Esd T C 14: 74,978,600 (GRCm39) L54S probably damaging Het
Exd1 C T 2: 119,350,807 (GRCm39) A485T probably benign Het
Gm3604 A T 13: 62,516,857 (GRCm39) N500K probably damaging Het
Grhl2 T A 15: 37,335,903 (GRCm39) probably null Het
Gsto1 C T 19: 47,852,830 (GRCm39) R222C probably benign Het
Inpp4a T A 1: 37,410,861 (GRCm39) M343K probably damaging Het
Itpripl2 T C 7: 118,090,280 (GRCm39) Q93R probably benign Het
Jakmip2 G A 18: 43,700,208 (GRCm39) T450I probably benign Het
Kdm6b A T 11: 69,294,620 (GRCm39) I1186N unknown Het
Kif1a T C 1: 92,948,931 (GRCm39) probably null Het
Klhl20 T C 1: 160,925,946 (GRCm39) K434R probably benign Het
Lemd3 T C 10: 120,767,853 (GRCm39) D697G probably damaging Het
Lipo3 A G 19: 33,753,987 (GRCm39) S383P probably damaging Het
Ltn1 C A 16: 87,176,582 (GRCm39) K1741N probably damaging Het
Lvrn A T 18: 47,038,418 (GRCm39) T991S probably damaging Het
Macroh2a2 C T 10: 61,575,132 (GRCm39) D355N possibly damaging Het
Mast3 C A 8: 71,241,559 (GRCm39) R151L possibly damaging Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Myoz1 T C 14: 20,705,377 (GRCm39) K14E probably damaging Het
Neb G T 2: 52,082,532 (GRCm39) Q5450K probably damaging Het
Nedd1 T A 10: 92,522,120 (GRCm39) N639I probably damaging Het
Nlrp4e A T 7: 23,036,165 (GRCm39) N673Y probably benign Het
Nop53 C T 7: 15,676,129 (GRCm39) R190Q probably damaging Het
Notch4 T C 17: 34,789,092 (GRCm39) Y468H probably damaging Het
Obscn T C 11: 58,958,433 (GRCm39) T3507A probably damaging Het
Opn5 T C 17: 42,922,187 (GRCm39) H5R probably benign Het
Or4l15 T C 14: 50,197,681 (GRCm39) N283D probably damaging Het
Patl1 T C 19: 11,902,515 (GRCm39) M349T probably benign Het
Phactr3 A G 2: 177,925,811 (GRCm39) N362S probably damaging Het
Pirb C T 7: 3,720,602 (GRCm39) G299S probably benign Het
Rapgef5 G A 12: 117,719,809 (GRCm39) R579Q probably damaging Het
Rgl1 T C 1: 152,430,081 (GRCm39) D234G probably benign Het
Serpinb3a C T 1: 106,976,316 (GRCm39) E122K probably benign Het
Slc22a15 T C 3: 101,782,919 (GRCm39) probably benign Het
Slc25a12 A T 2: 71,127,149 (GRCm39) V344E probably damaging Het
Slc43a2 T C 11: 75,434,119 (GRCm39) L99P probably damaging Het
Smim27 G T 4: 40,269,719 (GRCm39) probably null Het
Smtn A G 11: 3,470,736 (GRCm39) probably benign Het
Szt2 A T 4: 118,226,445 (GRCm39) Y3001N unknown Het
Tgfbr3 G T 5: 107,257,585 (GRCm39) P825T probably damaging Het
Tnpo3 T C 6: 29,568,937 (GRCm39) T472A probably benign Het
Trf T A 9: 103,105,114 (GRCm39) D66V probably damaging Het
Vmn1r124 A G 7: 20,993,624 (GRCm39) C307R probably damaging Het
Vps13b T A 15: 35,452,370 (GRCm39) F656Y possibly damaging Het
Zic1 G T 9: 91,244,584 (GRCm39) S358R probably damaging Het
Other mutations in Agbl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Agbl5 APN 5 31,050,578 (GRCm39) missense probably benign 0.00
sausage UTSW 5 31,051,702 (GRCm39) nonsense probably null
R0355:Agbl5 UTSW 5 31,049,335 (GRCm39) critical splice donor site probably null
R0575:Agbl5 UTSW 5 31,051,798 (GRCm39) missense probably damaging 1.00
R1694:Agbl5 UTSW 5 31,050,726 (GRCm39) missense probably damaging 1.00
R1709:Agbl5 UTSW 5 31,063,585 (GRCm39) missense probably damaging 1.00
R1829:Agbl5 UTSW 5 31,060,408 (GRCm39) missense possibly damaging 0.66
R2434:Agbl5 UTSW 5 31,051,357 (GRCm39) missense probably damaging 0.97
R3418:Agbl5 UTSW 5 31,062,067 (GRCm39) missense probably damaging 1.00
R4827:Agbl5 UTSW 5 31,053,158 (GRCm39) missense probably damaging 1.00
R4828:Agbl5 UTSW 5 31,048,059 (GRCm39) missense probably damaging 1.00
R5017:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5018:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5036:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5038:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5052:Agbl5 UTSW 5 31,048,558 (GRCm39) missense possibly damaging 0.76
R5071:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5073:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5074:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5081:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5083:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5103:Agbl5 UTSW 5 31,051,345 (GRCm39) missense probably damaging 1.00
R5107:Agbl5 UTSW 5 31,049,822 (GRCm39) missense probably damaging 1.00
R5130:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5395:Agbl5 UTSW 5 31,047,682 (GRCm39) missense probably damaging 1.00
R5522:Agbl5 UTSW 5 31,051,247 (GRCm39) splice site probably null
R5524:Agbl5 UTSW 5 31,051,247 (GRCm39) splice site probably null
R5526:Agbl5 UTSW 5 31,051,247 (GRCm39) splice site probably null
R5657:Agbl5 UTSW 5 31,051,390 (GRCm39) missense probably damaging 1.00
R5790:Agbl5 UTSW 5 31,051,702 (GRCm39) nonsense probably null
R6301:Agbl5 UTSW 5 31,049,177 (GRCm39) missense probably damaging 1.00
R6891:Agbl5 UTSW 5 31,052,522 (GRCm39) missense probably damaging 1.00
R6919:Agbl5 UTSW 5 31,062,061 (GRCm39) missense probably benign 0.13
R7388:Agbl5 UTSW 5 31,060,583 (GRCm39) nonsense probably null
R7392:Agbl5 UTSW 5 31,048,115 (GRCm39) critical splice donor site probably null
R7410:Agbl5 UTSW 5 31,048,032 (GRCm39) missense possibly damaging 0.94
R7452:Agbl5 UTSW 5 31,050,735 (GRCm39) missense probably damaging 1.00
R8312:Agbl5 UTSW 5 31,051,850 (GRCm39) missense probably damaging 1.00
R8901:Agbl5 UTSW 5 31,048,435 (GRCm39) missense possibly damaging 0.58
RF007:Agbl5 UTSW 5 31,060,589 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GCACCAGCACAGTATCTCTTG -3'
(R):5'- ACCAGCTTCTTCAGGCTTGC -3'

Sequencing Primer
(F):5'- AGCACAGTATCTCTTGTAAACCCTC -3'
(R):5'- CAGGGGCTCAGCTTGGAC -3'
Posted On 2016-03-01