Incidental Mutation 'R4830:Dmpk'
ID372738
Institutional Source Beutler Lab
Gene Symbol Dmpk
Ensembl Gene ENSMUSG00000030409
Gene Namedystrophia myotonica-protein kinase
SynonymsDM, Dm15
MMRRC Submission 042446-MU
Accession Numbers

NCBI RefSeq: NM_032418.2, NM_001190490.1, NM_001190491.1; MGI: 94906

Is this an essential gene? Possibly essential (E-score: 0.557) question?
Stock #R4830 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19083849-19093821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19087528 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 237 (Y237F)
Ref Sequence ENSEMBL: ENSMUSP00000118459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032568] [ENSMUST00000032570] [ENSMUST00000108473] [ENSMUST00000108474] [ENSMUST00000108479] [ENSMUST00000122999] [ENSMUST00000154199]
Predicted Effect probably damaging
Transcript: ENSMUST00000032568
AA Change: Y237F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032568
Gene: ENSMUSG00000030409
AA Change: Y237F

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 6.5e-87 SMART
S_TK_X 340 407 3.6e-11 SMART
Pfam:DMPK_coil 472 532 2.8e-25 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032570
SMART Domains Protein: ENSMUSP00000032570
Gene: ENSMUSG00000030410

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 653 662 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108473
AA Change: Y237F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104113
Gene: ENSMUSG00000030409
AA Change: Y237F

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 407 7.5e-9 SMART
Pfam:DMPK_coil 472 532 2.2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108474
AA Change: Y237F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104114
Gene: ENSMUSG00000030409
AA Change: Y237F

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 336 2.57e-76 SMART
Pfam:DMPK_coil 446 506 2.4e-28 PFAM
low complexity region 564 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108479
SMART Domains Protein: ENSMUSP00000104119
Gene: ENSMUSG00000030410

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 628 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122999
SMART Domains Protein: ENSMUSP00000123516
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
PDB:2VD5|B 32 139 3e-62 PDB
SCOP:d1koba_ 44 139 3e-21 SMART
Blast:S_TKc 71 139 7e-36 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152050
Predicted Effect probably damaging
Transcript: ENSMUST00000154199
AA Change: Y237F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118459
Gene: ENSMUSG00000030409
AA Change: Y237F

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 402 5.3e-9 SMART
Pfam:DMPK_coil 467 527 2.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174918
Meta Mutation Damage Score 0.5003 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (71/73)
MGI Phenotype Strain: 3054407; 2182402
FUNCTION: The protein encoded by this gene is a serine/threonine protein kinase that contains coiled-coil and C-terminal membrane association domains. In the embryonic mouse, it is found in cardiac and skeletal myocytes where it appears to play a role in myogenesis. In adults, the transcript is localized to several tissues including brain, heart, and skeletal and smooth muscle, and a function in cytoskeletal remodeling has been described. Transcripts with expanded CUG repeats in the 3' untranslated region mediate alternative splicing of several genes and sequester RNA binding proteins and RNA transcripts that contain CAG repeats, resulting in myotonic dystrophy, an autosomal dominant neuromuscular disorder. Alternative splicing results in multiple protein coding and non-coding transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a null mutation exhibit abnormal sodium channel gating in cardiac myocytes, cardiac conduction defects, and late-onset progressive skeletal myopathy. Homozygotes for a second null mutation do not develop skeletal myopathy but do have abnormal muscle intracellular calcium levels. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 C A 3: 121,760,284 G643V probably damaging Het
Adamtsl1 A G 4: 86,356,382 E1225G probably damaging Het
Agbl5 G A 5: 30,890,715 R111H probably damaging Het
Ankle2 A C 5: 110,242,013 K446Q probably damaging Het
Boc A C 16: 44,490,157 M800R probably damaging Het
Ccnt1 A T 15: 98,543,451 N645K probably damaging Het
Cd93 G A 2: 148,443,379 Q16* probably null Het
Cpsf4l G T 11: 113,709,502 probably benign Het
Cuzd1 T A 7: 131,318,054 D111V probably damaging Het
Dab2 T C 15: 6,427,527 C232R probably benign Het
Dnah6 T A 6: 73,044,762 T3526S possibly damaging Het
Dock2 T C 11: 34,273,767 probably null Het
Dsp G A 13: 38,192,864 V1542I probably benign Het
Dst T A 1: 34,198,505 probably null Het
Esd T C 14: 74,741,160 L54S probably damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Gm3604 A T 13: 62,369,043 N500K probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grhl2 T A 15: 37,335,659 probably null Het
Gsto1 C T 19: 47,864,391 R222C probably benign Het
H2afy2 C T 10: 61,739,353 D355N possibly damaging Het
Inpp4a T A 1: 37,371,780 M343K probably damaging Het
Itpripl2 T C 7: 118,491,057 Q93R probably benign Het
Jakmip2 G A 18: 43,567,143 T450I probably benign Het
Kdm6b A T 11: 69,403,794 I1186N unknown Het
Kif1a T C 1: 93,021,209 probably null Het
Klhl20 T C 1: 161,098,376 K434R probably benign Het
Lemd3 T C 10: 120,931,948 D697G probably damaging Het
Lipo1 A G 19: 33,776,587 S383P probably damaging Het
Ltn1 C A 16: 87,379,694 K1741N probably damaging Het
Lvrn A T 18: 46,905,351 T991S probably damaging Het
Mast3 C A 8: 70,788,915 R151L possibly damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myoz1 T C 14: 20,655,309 K14E probably damaging Het
Neb G T 2: 52,192,520 Q5450K probably damaging Het
Nedd1 T A 10: 92,686,258 N639I probably damaging Het
Nlrp4e A T 7: 23,336,740 N673Y probably benign Het
Nop53 C T 7: 15,942,204 R190Q probably damaging Het
Notch4 T C 17: 34,570,118 Y468H probably damaging Het
Obscn T C 11: 59,067,607 T3507A probably damaging Het
Olfr724 T C 14: 49,960,224 N283D probably damaging Het
Opn5 T C 17: 42,611,296 H5R probably benign Het
Patl1 T C 19: 11,925,151 M349T probably benign Het
Phactr3 A G 2: 178,284,018 N362S probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Rapgef5 G A 12: 117,756,074 R579Q probably damaging Het
Rgl1 T C 1: 152,554,330 D234G probably benign Het
Serpinb3a C T 1: 107,048,586 E122K probably benign Het
Slc22a15 T C 3: 101,875,603 probably benign Het
Slc25a12 A T 2: 71,296,805 V344E probably damaging Het
Slc43a2 T C 11: 75,543,293 L99P probably damaging Het
Smim27 G T 4: 40,269,719 probably null Het
Smtn A G 11: 3,520,736 probably benign Het
Szt2 A T 4: 118,369,248 Y3001N unknown Het
Tgfbr3 G T 5: 107,109,719 P825T probably damaging Het
Tnpo3 T C 6: 29,568,938 T472A probably benign Het
Trf T A 9: 103,227,915 D66V probably damaging Het
Vmn1r124 A G 7: 21,259,699 C307R probably damaging Het
Vps13b T A 15: 35,452,224 F656Y possibly damaging Het
Zic1 G T 9: 91,362,531 S358R probably damaging Het
Other mutations in Dmpk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02198:Dmpk APN 7 19088192 missense probably damaging 0.98
IGL02874:Dmpk APN 7 19087001 missense possibly damaging 0.75
IGL02942:Dmpk APN 7 19092241 missense probably damaging 0.99
IGL03081:Dmpk APN 7 19087533 missense probably damaging 1.00
IGL03258:Dmpk APN 7 19092206 critical splice acceptor site probably null
IGL03302:Dmpk APN 7 19086486 splice site probably benign
P0008:Dmpk UTSW 7 19088062 missense possibly damaging 0.89
R0388:Dmpk UTSW 7 19084077 unclassified probably benign
R0961:Dmpk UTSW 7 19087270 missense probably damaging 0.99
R3103:Dmpk UTSW 7 19087654 missense probably damaging 1.00
R3157:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3158:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3159:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3498:Dmpk UTSW 7 19086381 missense probably damaging 1.00
R4696:Dmpk UTSW 7 19088214 missense probably damaging 1.00
R4991:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5156:Dmpk UTSW 7 19084125 missense probably damaging 1.00
R5169:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5170:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5171:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5172:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5198:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5200:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5202:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5205:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5383:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5449:Dmpk UTSW 7 19090991 missense probably benign 0.18
R5639:Dmpk UTSW 7 19092600 missense probably benign 0.22
R5874:Dmpk UTSW 7 19092082 intron probably benign
R6939:Dmpk UTSW 7 19088224 missense probably damaging 0.97
R7133:Dmpk UTSW 7 19087307 missense probably damaging 1.00
R7352:Dmpk UTSW 7 19086072 missense probably damaging 0.98
R8032:Dmpk UTSW 7 19088053 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TCAAACTGCAGCCTGATGGAATG -3'
(R):5'- TTGTGCTCACCCTGTAGTGC -3'

Sequencing Primer
(F):5'- GGCGAAACTCTCCTCATTGGTG -3'
(R):5'- CCTGTAGTGCACAATCTTGGCATATG -3'
Posted On2016-03-01