Incidental Mutation 'R4830:Zic1'
ID372745
Institutional Source Beutler Lab
Gene Symbol Zic1
Ensembl Gene ENSMUSG00000032368
Gene Namezinc finger protein of the cerebellum 1
Synonymsodd-paired homolog
MMRRC Submission 042446-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R4830 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location91358058-91365810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 91362531 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 358 (S358R)
Ref Sequence ENSEMBL: ENSMUSP00000068858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034927] [ENSMUST00000065360] [ENSMUST00000173342]
Predicted Effect probably damaging
Transcript: ENSMUST00000034927
AA Change: S358R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034927
Gene: ENSMUSG00000032368
AA Change: S358R

DomainStartEndE-ValueType
low complexity region 68 85 N/A INTRINSIC
low complexity region 110 134 N/A INTRINSIC
ZnF_C2H2 238 260 6.82e1 SMART
ZnF_C2H2 269 296 7.49e0 SMART
ZnF_C2H2 302 326 8.02e-5 SMART
ZnF_C2H2 332 356 1.58e-3 SMART
ZnF_C2H2 362 384 4.54e-4 SMART
low complexity region 386 400 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000065360
AA Change: S358R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068858
Gene: ENSMUSG00000032368
AA Change: S358R

DomainStartEndE-ValueType
low complexity region 68 85 N/A INTRINSIC
low complexity region 110 134 N/A INTRINSIC
ZnF_C2H2 238 260 6.82e1 SMART
ZnF_C2H2 269 296 7.49e0 SMART
ZnF_C2H2 302 326 8.02e-5 SMART
ZnF_C2H2 332 356 1.58e-3 SMART
ZnF_C2H2 362 384 4.54e-4 SMART
low complexity region 386 400 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173121
SMART Domains Protein: ENSMUSP00000134006
Gene: ENSMUSG00000032368

DomainStartEndE-ValueType
ZnF_C2H2 10 32 4.54e-4 SMART
low complexity region 34 48 N/A INTRINSIC
low complexity region 51 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173342
Meta Mutation Damage Score 0.1192 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. Members of this family are important during development. Aberrant expression of this gene is seen in medulloblastoma, a childhood brain tumor. This gene is closely linked to the gene encoding zinc finger protein of the cerebellum 4, a related family member on chromosome 3. This gene encodes a transcription factor that can bind and transactivate the apolipoprotein E gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show cerebellar hypoplasia with a missing lobule of the anterior lobe. Newborn pups suckle poorly. 50% die within one day of birth and almost all die within 3 weeks; longer survivors show marked ataxia and exhibit tonic convulsions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 C A 3: 121,760,284 G643V probably damaging Het
Adamtsl1 A G 4: 86,356,382 E1225G probably damaging Het
Agbl5 G A 5: 30,890,715 R111H probably damaging Het
Ankle2 A C 5: 110,242,013 K446Q probably damaging Het
Boc A C 16: 44,490,157 M800R probably damaging Het
Ccnt1 A T 15: 98,543,451 N645K probably damaging Het
Cd93 G A 2: 148,443,379 Q16* probably null Het
Cpsf4l G T 11: 113,709,502 probably benign Het
Cuzd1 T A 7: 131,318,054 D111V probably damaging Het
Dab2 T C 15: 6,427,527 C232R probably benign Het
Dmpk A T 7: 19,087,528 Y237F probably damaging Het
Dnah6 T A 6: 73,044,762 T3526S possibly damaging Het
Dock2 T C 11: 34,273,767 probably null Het
Dsp G A 13: 38,192,864 V1542I probably benign Het
Dst T A 1: 34,198,505 probably null Het
Esd T C 14: 74,741,160 L54S probably damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Gm3604 A T 13: 62,369,043 N500K probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grhl2 T A 15: 37,335,659 probably null Het
Gsto1 C T 19: 47,864,391 R222C probably benign Het
H2afy2 C T 10: 61,739,353 D355N possibly damaging Het
Inpp4a T A 1: 37,371,780 M343K probably damaging Het
Itpripl2 T C 7: 118,491,057 Q93R probably benign Het
Jakmip2 G A 18: 43,567,143 T450I probably benign Het
Kdm6b A T 11: 69,403,794 I1186N unknown Het
Kif1a T C 1: 93,021,209 probably null Het
Klhl20 T C 1: 161,098,376 K434R probably benign Het
Lemd3 T C 10: 120,931,948 D697G probably damaging Het
Lipo1 A G 19: 33,776,587 S383P probably damaging Het
Ltn1 C A 16: 87,379,694 K1741N probably damaging Het
Lvrn A T 18: 46,905,351 T991S probably damaging Het
Mast3 C A 8: 70,788,915 R151L possibly damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myoz1 T C 14: 20,655,309 K14E probably damaging Het
Neb G T 2: 52,192,520 Q5450K probably damaging Het
Nedd1 T A 10: 92,686,258 N639I probably damaging Het
Nlrp4e A T 7: 23,336,740 N673Y probably benign Het
Nop53 C T 7: 15,942,204 R190Q probably damaging Het
Notch4 T C 17: 34,570,118 Y468H probably damaging Het
Obscn T C 11: 59,067,607 T3507A probably damaging Het
Olfr724 T C 14: 49,960,224 N283D probably damaging Het
Opn5 T C 17: 42,611,296 H5R probably benign Het
Patl1 T C 19: 11,925,151 M349T probably benign Het
Phactr3 A G 2: 178,284,018 N362S probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Rapgef5 G A 12: 117,756,074 R579Q probably damaging Het
Rgl1 T C 1: 152,554,330 D234G probably benign Het
Serpinb3a C T 1: 107,048,586 E122K probably benign Het
Slc22a15 T C 3: 101,875,603 probably benign Het
Slc25a12 A T 2: 71,296,805 V344E probably damaging Het
Slc43a2 T C 11: 75,543,293 L99P probably damaging Het
Smim27 G T 4: 40,269,719 probably null Het
Smtn A G 11: 3,520,736 probably benign Het
Szt2 A T 4: 118,369,248 Y3001N unknown Het
Tgfbr3 G T 5: 107,109,719 P825T probably damaging Het
Tnpo3 T C 6: 29,568,938 T472A probably benign Het
Trf T A 9: 103,227,915 D66V probably damaging Het
Vmn1r124 A G 7: 21,259,699 C307R probably damaging Het
Vps13b T A 15: 35,452,224 F656Y possibly damaging Het
Other mutations in Zic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02022:Zic1 APN 9 91362472 utr 5 prime probably null
IGL02669:Zic1 APN 9 91364433 missense possibly damaging 0.71
IGL02968:Zic1 APN 9 91362490 missense probably damaging 1.00
PIT4812001:Zic1 UTSW 9 91364341 missense probably damaging 1.00
R1493:Zic1 UTSW 9 91364756 missense probably damaging 1.00
R1599:Zic1 UTSW 9 91361688 missense probably benign 0.08
R1742:Zic1 UTSW 9 91361576 missense probably damaging 0.98
R2158:Zic1 UTSW 9 91364893 missense possibly damaging 0.73
R4587:Zic1 UTSW 9 91364822 missense probably damaging 1.00
R4735:Zic1 UTSW 9 91364505 missense possibly damaging 0.55
R5186:Zic1 UTSW 9 91364371 missense probably damaging 1.00
R5702:Zic1 UTSW 9 91364080 missense probably damaging 0.99
R6298:Zic1 UTSW 9 91364503 missense probably damaging 1.00
R7221:Zic1 UTSW 9 91364732 missense probably damaging 1.00
R7250:Zic1 UTSW 9 91364975 missense probably damaging 0.99
R7764:Zic1 UTSW 9 91365692 intron probably benign
R7806:Zic1 UTSW 9 91364971 missense probably damaging 1.00
RF011:Zic1 UTSW 9 91364330 missense probably benign 0.00
Z1177:Zic1 UTSW 9 91364579 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAAACCCTTTGCCTTTCCG -3'
(R):5'- CTCCAGATTTTAAGCTCGGGG -3'

Sequencing Primer
(F):5'- CCTCCTGCGGCTCCTGC -3'
(R):5'- CAACTTTTACGTTAGGGGAG -3'
Posted On2016-03-01