Incidental Mutation 'R4830:Trf'
ID372746
Institutional Source Beutler Lab
Gene Symbol Trf
Ensembl Gene ENSMUSG00000032554
Gene Nametransferrin
SynonymsHP, Tfn
MMRRC Submission 042446-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4830 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location103204001-103230444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103227915 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 66 (D66V)
Ref Sequence ENSEMBL: ENSMUSP00000108264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035158] [ENSMUST00000112645] [ENSMUST00000126359] [ENSMUST00000164377] [ENSMUST00000165296] [ENSMUST00000166836]
Predicted Effect probably damaging
Transcript: ENSMUST00000035158
AA Change: D66V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035158
Gene: ENSMUSG00000032554
AA Change: D66V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 352 5.04e-194 SMART
TR_FER 360 686 8.64e-193 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112645
AA Change: D66V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108264
Gene: ENSMUSG00000032554
AA Change: D66V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 352 5.04e-194 SMART
TR_FER 360 686 8.64e-193 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000126359
AA Change: D63V

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120472
Gene: ENSMUSG00000032554
AA Change: D63V

DomainStartEndE-ValueType
TR_FER 22 237 2.25e-77 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164377
AA Change: D66V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128647
Gene: ENSMUSG00000032554
AA Change: D66V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Transferrin 25 72 6.6e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165296
AA Change: D66V

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129013
Gene: ENSMUSG00000032554
AA Change: D66V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 171 5.58e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166836
AA Change: D66V

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127808
Gene: ENSMUSG00000090639
AA Change: D66V

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
TR_FER 25 338 4.98e-175 SMART
TR_FER 346 672 8.64e-193 SMART
Pfam:Arf 758 928 1.5e-15 PFAM
Pfam:SRPRB 769 948 1.4e-73 PFAM
Pfam:MMR_HSR1 773 888 7.8e-8 PFAM
Meta Mutation Damage Score 0.7878 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein with an approximate molecular weight of 76.5 kDa. It is thought to have been created as a result of an ancient gene duplication event that led to generation of homologous C and N-terminal domains each of which binds one ion of ferric iron. The function of this protein is to transport iron from the intestine, reticuloendothelial system, and liver parenchymal cells to all proliferating cells in the body. This protein may also have a physiologic role as granulocyte/pollen-binding protein (GPBP) involved in the removal of certain organic matter and allergens from serum. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit refractory iron-deficient, hypochromic, microcytic anemia with iron-loading in the liver, pancreas, heart and brain. Mutants usually die by two weeks of age. Heterozygotes show minor increases in iron stores. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 C A 3: 121,760,284 G643V probably damaging Het
Adamtsl1 A G 4: 86,356,382 E1225G probably damaging Het
Agbl5 G A 5: 30,890,715 R111H probably damaging Het
Ankle2 A C 5: 110,242,013 K446Q probably damaging Het
Boc A C 16: 44,490,157 M800R probably damaging Het
Ccnt1 A T 15: 98,543,451 N645K probably damaging Het
Cd93 G A 2: 148,443,379 Q16* probably null Het
Cpsf4l G T 11: 113,709,502 probably benign Het
Cuzd1 T A 7: 131,318,054 D111V probably damaging Het
Dab2 T C 15: 6,427,527 C232R probably benign Het
Dmpk A T 7: 19,087,528 Y237F probably damaging Het
Dnah6 T A 6: 73,044,762 T3526S possibly damaging Het
Dock2 T C 11: 34,273,767 probably null Het
Dsp G A 13: 38,192,864 V1542I probably benign Het
Dst T A 1: 34,198,505 probably null Het
Esd T C 14: 74,741,160 L54S probably damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Gm3604 A T 13: 62,369,043 N500K probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grhl2 T A 15: 37,335,659 probably null Het
Gsto1 C T 19: 47,864,391 R222C probably benign Het
H2afy2 C T 10: 61,739,353 D355N possibly damaging Het
Inpp4a T A 1: 37,371,780 M343K probably damaging Het
Itpripl2 T C 7: 118,491,057 Q93R probably benign Het
Jakmip2 G A 18: 43,567,143 T450I probably benign Het
Kdm6b A T 11: 69,403,794 I1186N unknown Het
Kif1a T C 1: 93,021,209 probably null Het
Klhl20 T C 1: 161,098,376 K434R probably benign Het
Lemd3 T C 10: 120,931,948 D697G probably damaging Het
Lipo1 A G 19: 33,776,587 S383P probably damaging Het
Ltn1 C A 16: 87,379,694 K1741N probably damaging Het
Lvrn A T 18: 46,905,351 T991S probably damaging Het
Mast3 C A 8: 70,788,915 R151L possibly damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myoz1 T C 14: 20,655,309 K14E probably damaging Het
Neb G T 2: 52,192,520 Q5450K probably damaging Het
Nedd1 T A 10: 92,686,258 N639I probably damaging Het
Nlrp4e A T 7: 23,336,740 N673Y probably benign Het
Nop53 C T 7: 15,942,204 R190Q probably damaging Het
Notch4 T C 17: 34,570,118 Y468H probably damaging Het
Obscn T C 11: 59,067,607 T3507A probably damaging Het
Olfr724 T C 14: 49,960,224 N283D probably damaging Het
Opn5 T C 17: 42,611,296 H5R probably benign Het
Patl1 T C 19: 11,925,151 M349T probably benign Het
Phactr3 A G 2: 178,284,018 N362S probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Rapgef5 G A 12: 117,756,074 R579Q probably damaging Het
Rgl1 T C 1: 152,554,330 D234G probably benign Het
Serpinb3a C T 1: 107,048,586 E122K probably benign Het
Slc22a15 T C 3: 101,875,603 probably benign Het
Slc25a12 A T 2: 71,296,805 V344E probably damaging Het
Slc43a2 T C 11: 75,543,293 L99P probably damaging Het
Smim27 G T 4: 40,269,719 probably null Het
Smtn A G 11: 3,520,736 probably benign Het
Szt2 A T 4: 118,369,248 Y3001N unknown Het
Tgfbr3 G T 5: 107,109,719 P825T probably damaging Het
Tnpo3 T C 6: 29,568,938 T472A probably benign Het
Vmn1r124 A G 7: 21,259,699 C307R probably damaging Het
Vps13b T A 15: 35,452,224 F656Y possibly damaging Het
Zic1 G T 9: 91,362,531 S358R probably damaging Het
Other mutations in Trf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Trf APN 9 103220957 missense probably benign 0.00
IGL00424:Trf APN 9 103226936 missense probably damaging 1.00
IGL00793:Trf APN 9 103226143 unclassified probably benign
IGL01139:Trf APN 9 103223604 missense probably damaging 1.00
IGL01658:Trf APN 9 103226856 missense probably benign 0.04
IGL02671:Trf APN 9 103211982 missense probably benign 0.01
IGL02996:Trf APN 9 103220903 missense probably benign 0.01
R0060:Trf UTSW 9 103220922 missense probably benign 0.11
R0060:Trf UTSW 9 103220922 missense probably benign 0.11
R0096:Trf UTSW 9 103222159 missense probably damaging 1.00
R0096:Trf UTSW 9 103222159 missense probably damaging 1.00
R0112:Trf UTSW 9 103226956 unclassified probably benign
R0234:Trf UTSW 9 103226879 unclassified probably null
R0234:Trf UTSW 9 103226879 unclassified probably null
R0411:Trf UTSW 9 103217501 missense probably damaging 1.00
R0456:Trf UTSW 9 103226903 missense probably damaging 1.00
R0601:Trf UTSW 9 103222933 critical splice donor site probably null
R1419:Trf UTSW 9 103226108 missense probably damaging 1.00
R1606:Trf UTSW 9 103225136 splice site probably null
R3943:Trf UTSW 9 103222952 missense probably benign 0.00
R4431:Trf UTSW 9 103211876 missense possibly damaging 0.81
R4609:Trf UTSW 9 103211985 missense possibly damaging 0.81
R4658:Trf UTSW 9 103223608 missense probably damaging 1.00
R4925:Trf UTSW 9 103219246 missense probably benign 0.00
R4929:Trf UTSW 9 103227875 intron probably benign
R4931:Trf UTSW 9 103228048 missense probably damaging 0.99
R5139:Trf UTSW 9 103222934 critical splice donor site probably null
R5272:Trf UTSW 9 103227978 missense probably damaging 1.00
R5692:Trf UTSW 9 103226125 missense possibly damaging 0.87
R6227:Trf UTSW 9 103230305 start gained probably benign
R6365:Trf UTSW 9 103222128 missense possibly damaging 0.70
R6928:Trf UTSW 9 103222108 missense possibly damaging 0.56
R7127:Trf UTSW 9 103225127 missense probably benign
R7231:Trf UTSW 9 103225148 missense probably damaging 1.00
R7648:Trf UTSW 9 103227969 missense probably benign 0.01
R8088:Trf UTSW 9 103211931 missense probably damaging 1.00
R8095:Trf UTSW 9 103210536 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGCCTTGGAATGATCCTCTTC -3'
(R):5'- CCTTCGTAAAGTGGTGCGTTC -3'

Sequencing Primer
(F):5'- GGAATGATCCTCTTCCTGCCAC -3'
(R):5'- AAAGTGGTGCGTTCTCTCC -3'
Posted On2016-03-01