Incidental Mutation 'R4830:Nedd1'
ID 372748
Institutional Source Beutler Lab
Gene Symbol Nedd1
Ensembl Gene ENSMUSG00000019988
Gene Name neural precursor cell expressed, developmentally down-regulated gene 1
Synonyms
MMRRC Submission 042446-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R4830 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 92520608-92558282 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 92522120 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 639 (N639I)
Ref Sequence ENSEMBL: ENSMUSP00000020163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020163]
AlphaFold P33215
Predicted Effect probably damaging
Transcript: ENSMUST00000020163
AA Change: N639I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020163
Gene: ENSMUSG00000019988
AA Change: N639I

DomainStartEndE-ValueType
WD40 21 63 5.97e-1 SMART
WD40 67 105 9.75e-3 SMART
WD40 108 147 6.19e-5 SMART
WD40 149 191 6.42e-1 SMART
WD40 194 235 9.1e-3 SMART
WD40 238 276 2.24e-2 SMART
low complexity region 555 568 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157787
Meta Mutation Damage Score 0.1857 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (71/73)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 C A 3: 121,553,933 (GRCm39) G643V probably damaging Het
Adamtsl1 A G 4: 86,274,619 (GRCm39) E1225G probably damaging Het
Agbl5 G A 5: 31,048,059 (GRCm39) R111H probably damaging Het
Ankle2 A C 5: 110,389,879 (GRCm39) K446Q probably damaging Het
Boc A C 16: 44,310,520 (GRCm39) M800R probably damaging Het
Ccnt1 A T 15: 98,441,332 (GRCm39) N645K probably damaging Het
Cd93 G A 2: 148,285,299 (GRCm39) Q16* probably null Het
Cpsf4l G T 11: 113,600,328 (GRCm39) probably benign Het
Cuzd1 T A 7: 130,919,783 (GRCm39) D111V probably damaging Het
Dab2 T C 15: 6,457,008 (GRCm39) C232R probably benign Het
Dmpk A T 7: 18,821,453 (GRCm39) Y237F probably damaging Het
Dnah6 T A 6: 73,021,745 (GRCm39) T3526S possibly damaging Het
Dock2 T C 11: 34,223,767 (GRCm39) probably null Het
Dsp G A 13: 38,376,840 (GRCm39) V1542I probably benign Het
Dst T A 1: 34,237,586 (GRCm39) probably null Het
Esd T C 14: 74,978,600 (GRCm39) L54S probably damaging Het
Exd1 C T 2: 119,350,807 (GRCm39) A485T probably benign Het
Gm3604 A T 13: 62,516,857 (GRCm39) N500K probably damaging Het
Grhl2 T A 15: 37,335,903 (GRCm39) probably null Het
Gsto1 C T 19: 47,852,830 (GRCm39) R222C probably benign Het
Inpp4a T A 1: 37,410,861 (GRCm39) M343K probably damaging Het
Itpripl2 T C 7: 118,090,280 (GRCm39) Q93R probably benign Het
Jakmip2 G A 18: 43,700,208 (GRCm39) T450I probably benign Het
Kdm6b A T 11: 69,294,620 (GRCm39) I1186N unknown Het
Kif1a T C 1: 92,948,931 (GRCm39) probably null Het
Klhl20 T C 1: 160,925,946 (GRCm39) K434R probably benign Het
Lemd3 T C 10: 120,767,853 (GRCm39) D697G probably damaging Het
Lipo3 A G 19: 33,753,987 (GRCm39) S383P probably damaging Het
Ltn1 C A 16: 87,176,582 (GRCm39) K1741N probably damaging Het
Lvrn A T 18: 47,038,418 (GRCm39) T991S probably damaging Het
Macroh2a2 C T 10: 61,575,132 (GRCm39) D355N possibly damaging Het
Mast3 C A 8: 71,241,559 (GRCm39) R151L possibly damaging Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Myoz1 T C 14: 20,705,377 (GRCm39) K14E probably damaging Het
Neb G T 2: 52,082,532 (GRCm39) Q5450K probably damaging Het
Nlrp4e A T 7: 23,036,165 (GRCm39) N673Y probably benign Het
Nop53 C T 7: 15,676,129 (GRCm39) R190Q probably damaging Het
Notch4 T C 17: 34,789,092 (GRCm39) Y468H probably damaging Het
Obscn T C 11: 58,958,433 (GRCm39) T3507A probably damaging Het
Opn5 T C 17: 42,922,187 (GRCm39) H5R probably benign Het
Or4l15 T C 14: 50,197,681 (GRCm39) N283D probably damaging Het
Patl1 T C 19: 11,902,515 (GRCm39) M349T probably benign Het
Phactr3 A G 2: 177,925,811 (GRCm39) N362S probably damaging Het
Pirb C T 7: 3,720,602 (GRCm39) G299S probably benign Het
Rapgef5 G A 12: 117,719,809 (GRCm39) R579Q probably damaging Het
Rgl1 T C 1: 152,430,081 (GRCm39) D234G probably benign Het
Serpinb3a C T 1: 106,976,316 (GRCm39) E122K probably benign Het
Slc22a15 T C 3: 101,782,919 (GRCm39) probably benign Het
Slc25a12 A T 2: 71,127,149 (GRCm39) V344E probably damaging Het
Slc43a2 T C 11: 75,434,119 (GRCm39) L99P probably damaging Het
Smim27 G T 4: 40,269,719 (GRCm39) probably null Het
Smtn A G 11: 3,470,736 (GRCm39) probably benign Het
Szt2 A T 4: 118,226,445 (GRCm39) Y3001N unknown Het
Tgfbr3 G T 5: 107,257,585 (GRCm39) P825T probably damaging Het
Tnpo3 T C 6: 29,568,937 (GRCm39) T472A probably benign Het
Trf T A 9: 103,105,114 (GRCm39) D66V probably damaging Het
Vmn1r124 A G 7: 20,993,624 (GRCm39) C307R probably damaging Het
Vps13b T A 15: 35,452,370 (GRCm39) F656Y possibly damaging Het
Zic1 G T 9: 91,244,584 (GRCm39) S358R probably damaging Het
Other mutations in Nedd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Nedd1 APN 10 92,530,836 (GRCm39) splice site probably benign
IGL00988:Nedd1 APN 10 92,525,548 (GRCm39) missense possibly damaging 0.71
IGL01563:Nedd1 APN 10 92,534,031 (GRCm39) critical splice donor site probably null
IGL01588:Nedd1 APN 10 92,522,124 (GRCm39) missense probably benign 0.12
IGL01988:Nedd1 APN 10 92,550,021 (GRCm39) missense probably benign 0.39
IGL02706:Nedd1 APN 10 92,522,147 (GRCm39) missense possibly damaging 0.88
IGL02938:Nedd1 APN 10 92,525,519 (GRCm39) nonsense probably null
IGL03011:Nedd1 APN 10 92,525,503 (GRCm39) missense possibly damaging 0.92
Brainless UTSW 10 92,526,635 (GRCm39) missense probably benign 0.01
R0125:Nedd1 UTSW 10 92,527,791 (GRCm39) missense possibly damaging 0.93
R0173:Nedd1 UTSW 10 92,534,745 (GRCm39) missense probably benign 0.30
R0244:Nedd1 UTSW 10 92,552,127 (GRCm39) intron probably benign
R0645:Nedd1 UTSW 10 92,527,693 (GRCm39) splice site probably null
R0791:Nedd1 UTSW 10 92,555,476 (GRCm39) missense probably damaging 1.00
R1490:Nedd1 UTSW 10 92,536,660 (GRCm39) missense probably damaging 1.00
R1522:Nedd1 UTSW 10 92,555,476 (GRCm39) missense probably damaging 1.00
R1797:Nedd1 UTSW 10 92,534,601 (GRCm39) missense possibly damaging 0.46
R1984:Nedd1 UTSW 10 92,550,022 (GRCm39) missense possibly damaging 0.63
R2474:Nedd1 UTSW 10 92,555,465 (GRCm39) missense probably damaging 0.99
R2877:Nedd1 UTSW 10 92,549,988 (GRCm39) missense possibly damaging 0.89
R2883:Nedd1 UTSW 10 92,530,860 (GRCm39) missense probably damaging 0.98
R4694:Nedd1 UTSW 10 92,555,444 (GRCm39) missense probably benign 0.00
R4798:Nedd1 UTSW 10 92,534,772 (GRCm39) missense probably benign 0.00
R4963:Nedd1 UTSW 10 92,530,893 (GRCm39) missense probably damaging 1.00
R5174:Nedd1 UTSW 10 92,547,074 (GRCm39) missense possibly damaging 0.77
R5329:Nedd1 UTSW 10 92,522,102 (GRCm39) missense probably damaging 1.00
R5404:Nedd1 UTSW 10 92,552,054 (GRCm39) missense probably benign 0.04
R5534:Nedd1 UTSW 10 92,530,894 (GRCm39) missense probably benign 0.01
R6045:Nedd1 UTSW 10 92,530,962 (GRCm39) nonsense probably null
R6154:Nedd1 UTSW 10 92,534,104 (GRCm39) missense possibly damaging 0.65
R6512:Nedd1 UTSW 10 92,527,737 (GRCm39) missense probably benign
R6692:Nedd1 UTSW 10 92,534,199 (GRCm39) missense possibly damaging 0.88
R6693:Nedd1 UTSW 10 92,534,199 (GRCm39) missense possibly damaging 0.88
R6943:Nedd1 UTSW 10 92,547,168 (GRCm39) missense probably damaging 1.00
R7011:Nedd1 UTSW 10 92,526,635 (GRCm39) missense probably benign 0.01
R7406:Nedd1 UTSW 10 92,547,185 (GRCm39) splice site probably null
R7455:Nedd1 UTSW 10 92,536,787 (GRCm39) missense probably benign 0.01
R7587:Nedd1 UTSW 10 92,534,592 (GRCm39) missense probably benign 0.01
R7745:Nedd1 UTSW 10 92,550,034 (GRCm39) missense probably benign
R8104:Nedd1 UTSW 10 92,527,778 (GRCm39) missense probably damaging 1.00
R8209:Nedd1 UTSW 10 92,527,797 (GRCm39) missense probably benign
R8226:Nedd1 UTSW 10 92,527,797 (GRCm39) missense probably benign
R8925:Nedd1 UTSW 10 92,558,258 (GRCm39) start gained probably benign
R8927:Nedd1 UTSW 10 92,558,258 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- GATGGAATAGTGCGTGCTGC -3'
(R):5'- CAAAAGTATGACTGTAGATCTCCCCG -3'

Sequencing Primer
(F):5'- GTGCTGCAAAATCCACTTTCAAGG -3'
(R):5'- TCTCATGCAATCTTCCTGGTTAGG -3'
Posted On 2016-03-01