Incidental Mutation 'R4830:Smtn'
ID 372750
Institutional Source Beutler Lab
Gene Symbol Smtn
Ensembl Gene ENSMUSG00000020439
Gene Name smoothelin
Synonyms
MMRRC Submission 042446-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.515) question?
Stock # R4830 (G1)
Quality Score 207
Status Validated
Chromosome 11
Chromosomal Location 3467522-3489337 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to G at 3470736 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020718] [ENSMUST00000020721] [ENSMUST00000075118] [ENSMUST00000094469] [ENSMUST00000110011] [ENSMUST00000170588]
AlphaFold Q921U8
Predicted Effect probably benign
Transcript: ENSMUST00000020718
SMART Domains Protein: ENSMUSP00000020718
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 26 38 N/A INTRINSIC
coiled coil region 41 74 N/A INTRINSIC
low complexity region 75 100 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
Pfam:Smoothelin 154 208 1e-23 PFAM
low complexity region 212 236 N/A INTRINSIC
CH 322 421 1.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000020721
SMART Domains Protein: ENSMUSP00000020721
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.7e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 906 1.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075118
SMART Domains Protein: ENSMUSP00000074621
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.8e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 907 9.51e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094469
SMART Domains Protein: ENSMUSP00000092041
Gene: ENSMUSG00000075702

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Sep15_SelM 40 114 3.5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110011
SMART Domains Protein: ENSMUSP00000105638
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 2.5e-14 PFAM
Pfam:Smoothelin 72 122 8.5e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 568 617 6e-25 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 930 1.62e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154861
Predicted Effect probably benign
Transcript: ENSMUST00000170588
SMART Domains Protein: ENSMUSP00000133155
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.7e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 906 1.04e-22 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a structural protein that is found exclusively in contractile smooth muscle cells. It associates with stress fibers and constitutes part of the cytoskeleton. This gene is localized to chromosome 22q12.3, distal to the TUPLE1 locus and outside the DiGeorge syndrome deletion. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions of both the A and B isoforms of this gene display partial postnatal lethality, impaired intestinal smooth muscle contractility and thus hampered intestinal transit and diverticulosis. Mice lacking only the B isoform appearnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 C A 3: 121,553,933 (GRCm39) G643V probably damaging Het
Adamtsl1 A G 4: 86,274,619 (GRCm39) E1225G probably damaging Het
Agbl5 G A 5: 31,048,059 (GRCm39) R111H probably damaging Het
Ankle2 A C 5: 110,389,879 (GRCm39) K446Q probably damaging Het
Boc A C 16: 44,310,520 (GRCm39) M800R probably damaging Het
Ccnt1 A T 15: 98,441,332 (GRCm39) N645K probably damaging Het
Cd93 G A 2: 148,285,299 (GRCm39) Q16* probably null Het
Cpsf4l G T 11: 113,600,328 (GRCm39) probably benign Het
Cuzd1 T A 7: 130,919,783 (GRCm39) D111V probably damaging Het
Dab2 T C 15: 6,457,008 (GRCm39) C232R probably benign Het
Dmpk A T 7: 18,821,453 (GRCm39) Y237F probably damaging Het
Dnah6 T A 6: 73,021,745 (GRCm39) T3526S possibly damaging Het
Dock2 T C 11: 34,223,767 (GRCm39) probably null Het
Dsp G A 13: 38,376,840 (GRCm39) V1542I probably benign Het
Dst T A 1: 34,237,586 (GRCm39) probably null Het
Esd T C 14: 74,978,600 (GRCm39) L54S probably damaging Het
Exd1 C T 2: 119,350,807 (GRCm39) A485T probably benign Het
Gm3604 A T 13: 62,516,857 (GRCm39) N500K probably damaging Het
Grhl2 T A 15: 37,335,903 (GRCm39) probably null Het
Gsto1 C T 19: 47,852,830 (GRCm39) R222C probably benign Het
Inpp4a T A 1: 37,410,861 (GRCm39) M343K probably damaging Het
Itpripl2 T C 7: 118,090,280 (GRCm39) Q93R probably benign Het
Jakmip2 G A 18: 43,700,208 (GRCm39) T450I probably benign Het
Kdm6b A T 11: 69,294,620 (GRCm39) I1186N unknown Het
Kif1a T C 1: 92,948,931 (GRCm39) probably null Het
Klhl20 T C 1: 160,925,946 (GRCm39) K434R probably benign Het
Lemd3 T C 10: 120,767,853 (GRCm39) D697G probably damaging Het
Lipo3 A G 19: 33,753,987 (GRCm39) S383P probably damaging Het
Ltn1 C A 16: 87,176,582 (GRCm39) K1741N probably damaging Het
Lvrn A T 18: 47,038,418 (GRCm39) T991S probably damaging Het
Macroh2a2 C T 10: 61,575,132 (GRCm39) D355N possibly damaging Het
Mast3 C A 8: 71,241,559 (GRCm39) R151L possibly damaging Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Myoz1 T C 14: 20,705,377 (GRCm39) K14E probably damaging Het
Neb G T 2: 52,082,532 (GRCm39) Q5450K probably damaging Het
Nedd1 T A 10: 92,522,120 (GRCm39) N639I probably damaging Het
Nlrp4e A T 7: 23,036,165 (GRCm39) N673Y probably benign Het
Nop53 C T 7: 15,676,129 (GRCm39) R190Q probably damaging Het
Notch4 T C 17: 34,789,092 (GRCm39) Y468H probably damaging Het
Obscn T C 11: 58,958,433 (GRCm39) T3507A probably damaging Het
Opn5 T C 17: 42,922,187 (GRCm39) H5R probably benign Het
Or4l15 T C 14: 50,197,681 (GRCm39) N283D probably damaging Het
Patl1 T C 19: 11,902,515 (GRCm39) M349T probably benign Het
Phactr3 A G 2: 177,925,811 (GRCm39) N362S probably damaging Het
Pirb C T 7: 3,720,602 (GRCm39) G299S probably benign Het
Rapgef5 G A 12: 117,719,809 (GRCm39) R579Q probably damaging Het
Rgl1 T C 1: 152,430,081 (GRCm39) D234G probably benign Het
Serpinb3a C T 1: 106,976,316 (GRCm39) E122K probably benign Het
Slc22a15 T C 3: 101,782,919 (GRCm39) probably benign Het
Slc25a12 A T 2: 71,127,149 (GRCm39) V344E probably damaging Het
Slc43a2 T C 11: 75,434,119 (GRCm39) L99P probably damaging Het
Smim27 G T 4: 40,269,719 (GRCm39) probably null Het
Szt2 A T 4: 118,226,445 (GRCm39) Y3001N unknown Het
Tgfbr3 G T 5: 107,257,585 (GRCm39) P825T probably damaging Het
Tnpo3 T C 6: 29,568,937 (GRCm39) T472A probably benign Het
Trf T A 9: 103,105,114 (GRCm39) D66V probably damaging Het
Vmn1r124 A G 7: 20,993,624 (GRCm39) C307R probably damaging Het
Vps13b T A 15: 35,452,370 (GRCm39) F656Y possibly damaging Het
Zic1 G T 9: 91,244,584 (GRCm39) S358R probably damaging Het
Other mutations in Smtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Smtn APN 11 3,476,326 (GRCm39) critical splice donor site probably null
IGL02335:Smtn APN 11 3,476,215 (GRCm39) missense probably damaging 1.00
IGL02473:Smtn APN 11 3,482,463 (GRCm39) missense probably damaging 1.00
IGL02678:Smtn APN 11 3,476,353 (GRCm39) missense possibly damaging 0.95
IGL02824:Smtn APN 11 3,482,658 (GRCm39) missense probably damaging 1.00
IGL03067:Smtn APN 11 3,480,165 (GRCm39) missense possibly damaging 0.53
IGL03142:Smtn APN 11 3,482,601 (GRCm39) nonsense probably null
runtish UTSW 11 3,481,326 (GRCm39) missense possibly damaging 0.89
R0279:Smtn UTSW 11 3,480,235 (GRCm39) missense probably damaging 0.99
R0523:Smtn UTSW 11 3,474,664 (GRCm39) missense possibly damaging 0.89
R0855:Smtn UTSW 11 3,471,880 (GRCm39) missense probably damaging 1.00
R1080:Smtn UTSW 11 3,467,693 (GRCm39) missense probably damaging 1.00
R1218:Smtn UTSW 11 3,480,021 (GRCm39) missense probably benign
R1571:Smtn UTSW 11 3,480,102 (GRCm39) missense probably benign 0.00
R1899:Smtn UTSW 11 3,481,326 (GRCm39) missense possibly damaging 0.89
R2033:Smtn UTSW 11 3,467,781 (GRCm39) missense probably benign 0.43
R2126:Smtn UTSW 11 3,480,045 (GRCm39) missense probably benign 0.02
R2358:Smtn UTSW 11 3,482,865 (GRCm39) splice site probably null
R3690:Smtn UTSW 11 3,477,687 (GRCm39) intron probably benign
R3712:Smtn UTSW 11 3,482,865 (GRCm39) splice site probably null
R4108:Smtn UTSW 11 3,476,449 (GRCm39) missense probably benign 0.10
R4709:Smtn UTSW 11 3,474,663 (GRCm39) missense probably damaging 0.99
R4710:Smtn UTSW 11 3,474,663 (GRCm39) missense probably damaging 0.99
R4944:Smtn UTSW 11 3,472,916 (GRCm39) missense probably damaging 1.00
R4959:Smtn UTSW 11 3,477,825 (GRCm39) start codon destroyed probably null
R5223:Smtn UTSW 11 3,479,530 (GRCm39) missense probably benign 0.00
R5554:Smtn UTSW 11 3,470,811 (GRCm39) nonsense probably null
R5610:Smtn UTSW 11 3,479,582 (GRCm39) missense probably damaging 1.00
R5636:Smtn UTSW 11 3,467,829 (GRCm39) critical splice acceptor site probably null
R5972:Smtn UTSW 11 3,483,486 (GRCm39) missense probably damaging 1.00
R6108:Smtn UTSW 11 3,479,608 (GRCm39) missense probably damaging 0.99
R6227:Smtn UTSW 11 3,477,624 (GRCm39) intron probably benign
R7016:Smtn UTSW 11 3,480,368 (GRCm39) critical splice donor site probably null
R7423:Smtn UTSW 11 3,481,200 (GRCm39) critical splice donor site probably null
R7426:Smtn UTSW 11 3,480,249 (GRCm39) missense probably benign 0.10
R7447:Smtn UTSW 11 3,480,196 (GRCm39) missense probably benign
R7496:Smtn UTSW 11 3,479,988 (GRCm39) missense probably damaging 0.99
R7716:Smtn UTSW 11 3,474,708 (GRCm39) missense probably benign 0.00
R8762:Smtn UTSW 11 3,476,407 (GRCm39) missense probably benign 0.00
R8925:Smtn UTSW 11 3,479,477 (GRCm39) missense possibly damaging 0.68
R8927:Smtn UTSW 11 3,479,477 (GRCm39) missense possibly damaging 0.68
R8932:Smtn UTSW 11 3,472,908 (GRCm39) missense probably benign 0.01
R9137:Smtn UTSW 11 3,472,838 (GRCm39) missense possibly damaging 0.93
R9502:Smtn UTSW 11 3,482,780 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTTATAGCTTGCCATCCTGGG -3'
(R):5'- GCACCGAGAGCATTAACTGAAC -3'

Sequencing Primer
(F):5'- TGAGCCTGGGGTCTCCTG -3'
(R):5'- CGAGAGCATTAACTGAACTCATGTC -3'
Posted On 2016-03-01