Incidental Mutation 'R4830:Cpsf4l'
ID372754
Institutional Source Beutler Lab
Gene Symbol Cpsf4l
Ensembl Gene ENSMUSG00000018727
Gene Namecleavage and polyadenylation specific factor 4-like
Synonyms1500000C01Rik, 0610010C04Rik, D11Ertd636e
MMRRC Submission 042446-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R4830 (G1)
Quality Score156
Status Validated
Chromosome11
Chromosomal Location113698172-113710017 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) G to T at 113709502 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018871] [ENSMUST00000100248] [ENSMUST00000106617] [ENSMUST00000173655]
Predicted Effect probably benign
Transcript: ENSMUST00000018871
SMART Domains Protein: ENSMUSP00000018871
Gene: ENSMUSG00000018727

DomainStartEndE-ValueType
ZnF_C3H1 10 36 1.1e-2 SMART
ZnF_C3H1 38 64 4.64e-1 SMART
ZnF_C3H1 68 93 2.34e0 SMART
ZnF_C3H1 94 117 2.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100248
SMART Domains Protein: ENSMUSP00000097819
Gene: ENSMUSG00000018727

DomainStartEndE-ValueType
low complexity region 62 74 N/A INTRINSIC
ZnF_C3H1 89 114 3.38e-1 SMART
ZnF_C3H1 115 141 1.1e-2 SMART
ZnF_C3H1 143 169 4.64e-1 SMART
ZnF_C3H1 173 197 1.36e-2 SMART
ZnF_C3H1 198 221 5.21e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106617
SMART Domains Protein: ENSMUSP00000102228
Gene: ENSMUSG00000018727

DomainStartEndE-ValueType
ZnF_C3H1 10 36 1.1e-2 SMART
ZnF_C3H1 38 64 4.64e-1 SMART
ZnF_C3H1 68 93 2.34e0 SMART
ZnF_C3H1 94 117 5.21e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151396
Predicted Effect probably benign
Transcript: ENSMUST00000173655
SMART Domains Protein: ENSMUSP00000133451
Gene: ENSMUSG00000018727

DomainStartEndE-ValueType
ZnF_C3H1 35 61 1.33e-1 SMART
ZnF_C3H1 62 88 1.1e-2 SMART
ZnF_C3H1 90 116 4.64e-1 SMART
ZnF_C3H1 120 145 2.34e0 SMART
ZnF_C3H1 146 169 5.21e-1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (71/73)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 C A 3: 121,760,284 G643V probably damaging Het
Adamtsl1 A G 4: 86,356,382 E1225G probably damaging Het
Agbl5 G A 5: 30,890,715 R111H probably damaging Het
Ankle2 A C 5: 110,242,013 K446Q probably damaging Het
Boc A C 16: 44,490,157 M800R probably damaging Het
Ccnt1 A T 15: 98,543,451 N645K probably damaging Het
Cd93 G A 2: 148,443,379 Q16* probably null Het
Cuzd1 T A 7: 131,318,054 D111V probably damaging Het
Dab2 T C 15: 6,427,527 C232R probably benign Het
Dmpk A T 7: 19,087,528 Y237F probably damaging Het
Dnah6 T A 6: 73,044,762 T3526S possibly damaging Het
Dock2 T C 11: 34,273,767 probably null Het
Dsp G A 13: 38,192,864 V1542I probably benign Het
Dst T A 1: 34,198,505 probably null Het
Esd T C 14: 74,741,160 L54S probably damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Gm3604 A T 13: 62,369,043 N500K probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grhl2 T A 15: 37,335,659 probably null Het
Gsto1 C T 19: 47,864,391 R222C probably benign Het
H2afy2 C T 10: 61,739,353 D355N possibly damaging Het
Inpp4a T A 1: 37,371,780 M343K probably damaging Het
Itpripl2 T C 7: 118,491,057 Q93R probably benign Het
Jakmip2 G A 18: 43,567,143 T450I probably benign Het
Kdm6b A T 11: 69,403,794 I1186N unknown Het
Kif1a T C 1: 93,021,209 probably null Het
Klhl20 T C 1: 161,098,376 K434R probably benign Het
Lemd3 T C 10: 120,931,948 D697G probably damaging Het
Lipo1 A G 19: 33,776,587 S383P probably damaging Het
Ltn1 C A 16: 87,379,694 K1741N probably damaging Het
Lvrn A T 18: 46,905,351 T991S probably damaging Het
Mast3 C A 8: 70,788,915 R151L possibly damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myoz1 T C 14: 20,655,309 K14E probably damaging Het
Neb G T 2: 52,192,520 Q5450K probably damaging Het
Nedd1 T A 10: 92,686,258 N639I probably damaging Het
Nlrp4e A T 7: 23,336,740 N673Y probably benign Het
Nop53 C T 7: 15,942,204 R190Q probably damaging Het
Notch4 T C 17: 34,570,118 Y468H probably damaging Het
Obscn T C 11: 59,067,607 T3507A probably damaging Het
Olfr724 T C 14: 49,960,224 N283D probably damaging Het
Opn5 T C 17: 42,611,296 H5R probably benign Het
Patl1 T C 19: 11,925,151 M349T probably benign Het
Phactr3 A G 2: 178,284,018 N362S probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Rapgef5 G A 12: 117,756,074 R579Q probably damaging Het
Rgl1 T C 1: 152,554,330 D234G probably benign Het
Serpinb3a C T 1: 107,048,586 E122K probably benign Het
Slc22a15 T C 3: 101,875,603 probably benign Het
Slc25a12 A T 2: 71,296,805 V344E probably damaging Het
Slc43a2 T C 11: 75,543,293 L99P probably damaging Het
Smim27 G T 4: 40,269,719 probably null Het
Smtn A G 11: 3,520,736 probably benign Het
Szt2 A T 4: 118,369,248 Y3001N unknown Het
Tgfbr3 G T 5: 107,109,719 P825T probably damaging Het
Tnpo3 T C 6: 29,568,938 T472A probably benign Het
Trf T A 9: 103,227,915 D66V probably damaging Het
Vmn1r124 A G 7: 21,259,699 C307R probably damaging Het
Vps13b T A 15: 35,452,224 F656Y possibly damaging Het
Zic1 G T 9: 91,362,531 S358R probably damaging Het
Other mutations in Cpsf4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cpsf4l APN 11 113709218 intron probably benign
IGL02132:Cpsf4l APN 11 113699859 missense possibly damaging 0.84
IGL02427:Cpsf4l APN 11 113709498 utr 5 prime probably benign
R0790:Cpsf4l UTSW 11 113706408 splice site probably benign
R1700:Cpsf4l UTSW 11 113702075 missense probably benign 0.17
R1909:Cpsf4l UTSW 11 113703378 splice site probably null
R3522:Cpsf4l UTSW 11 113702493 missense probably damaging 1.00
R6006:Cpsf4l UTSW 11 113699927 missense probably benign 0.23
R6229:Cpsf4l UTSW 11 113708854 missense possibly damaging 0.89
R6593:Cpsf4l UTSW 11 113709366 intron probably benign
R7107:Cpsf4l UTSW 11 113702489 missense possibly damaging 0.55
R7373:Cpsf4l UTSW 11 113699831 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGAAGTCTGCCTTTCTATCCCG -3'
(R):5'- TCAGCCAGAAAGTCACGTG -3'

Sequencing Primer
(F):5'- TCTATCCCGGGCAGTGAATAC -3'
(R):5'- GAAAGTCACGTGCAGTCACCTG -3'
Posted On2016-03-01