Incidental Mutation 'R4830:Olfr724'
ID372760
Institutional Source Beutler Lab
Gene Symbol Olfr724
Ensembl Gene ENSMUSG00000096254
Gene Nameolfactory receptor 724
SynonymsGA_x6K02T2PMLR-5645801-5644872, MOR247-2
MMRRC Submission 042446-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock #R4830 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location49960023-49963274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49960224 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 283 (N283D)
Ref Sequence ENSEMBL: ENSMUSP00000149110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075030] [ENSMUST00000213390]
Predicted Effect probably damaging
Transcript: ENSMUST00000075030
AA Change: N283D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074546
Gene: ENSMUSG00000096254
AA Change: N283D

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.3e-42 PFAM
Pfam:7TM_GPCR_Srsx 34 302 3e-11 PFAM
Pfam:7tm_1 41 287 5.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213390
AA Change: N283D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6684 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 C A 3: 121,760,284 G643V probably damaging Het
Adamtsl1 A G 4: 86,356,382 E1225G probably damaging Het
Agbl5 G A 5: 30,890,715 R111H probably damaging Het
Ankle2 A C 5: 110,242,013 K446Q probably damaging Het
Boc A C 16: 44,490,157 M800R probably damaging Het
Ccnt1 A T 15: 98,543,451 N645K probably damaging Het
Cd93 G A 2: 148,443,379 Q16* probably null Het
Cpsf4l G T 11: 113,709,502 probably benign Het
Cuzd1 T A 7: 131,318,054 D111V probably damaging Het
Dab2 T C 15: 6,427,527 C232R probably benign Het
Dmpk A T 7: 19,087,528 Y237F probably damaging Het
Dnah6 T A 6: 73,044,762 T3526S possibly damaging Het
Dock2 T C 11: 34,273,767 probably null Het
Dsp G A 13: 38,192,864 V1542I probably benign Het
Dst T A 1: 34,198,505 probably null Het
Esd T C 14: 74,741,160 L54S probably damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Gm3604 A T 13: 62,369,043 N500K probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grhl2 T A 15: 37,335,659 probably null Het
Gsto1 C T 19: 47,864,391 R222C probably benign Het
H2afy2 C T 10: 61,739,353 D355N possibly damaging Het
Inpp4a T A 1: 37,371,780 M343K probably damaging Het
Itpripl2 T C 7: 118,491,057 Q93R probably benign Het
Jakmip2 G A 18: 43,567,143 T450I probably benign Het
Kdm6b A T 11: 69,403,794 I1186N unknown Het
Kif1a T C 1: 93,021,209 probably null Het
Klhl20 T C 1: 161,098,376 K434R probably benign Het
Lemd3 T C 10: 120,931,948 D697G probably damaging Het
Lipo1 A G 19: 33,776,587 S383P probably damaging Het
Ltn1 C A 16: 87,379,694 K1741N probably damaging Het
Lvrn A T 18: 46,905,351 T991S probably damaging Het
Mast3 C A 8: 70,788,915 R151L possibly damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myoz1 T C 14: 20,655,309 K14E probably damaging Het
Neb G T 2: 52,192,520 Q5450K probably damaging Het
Nedd1 T A 10: 92,686,258 N639I probably damaging Het
Nlrp4e A T 7: 23,336,740 N673Y probably benign Het
Nop53 C T 7: 15,942,204 R190Q probably damaging Het
Notch4 T C 17: 34,570,118 Y468H probably damaging Het
Obscn T C 11: 59,067,607 T3507A probably damaging Het
Opn5 T C 17: 42,611,296 H5R probably benign Het
Patl1 T C 19: 11,925,151 M349T probably benign Het
Phactr3 A G 2: 178,284,018 N362S probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Rapgef5 G A 12: 117,756,074 R579Q probably damaging Het
Rgl1 T C 1: 152,554,330 D234G probably benign Het
Serpinb3a C T 1: 107,048,586 E122K probably benign Het
Slc22a15 T C 3: 101,875,603 probably benign Het
Slc25a12 A T 2: 71,296,805 V344E probably damaging Het
Slc43a2 T C 11: 75,543,293 L99P probably damaging Het
Smim27 G T 4: 40,269,719 probably null Het
Smtn A G 11: 3,520,736 probably benign Het
Szt2 A T 4: 118,369,248 Y3001N unknown Het
Tgfbr3 G T 5: 107,109,719 P825T probably damaging Het
Tnpo3 T C 6: 29,568,938 T472A probably benign Het
Trf T A 9: 103,227,915 D66V probably damaging Het
Vmn1r124 A G 7: 21,259,699 C307R probably damaging Het
Vps13b T A 15: 35,452,224 F656Y possibly damaging Het
Zic1 G T 9: 91,362,531 S358R probably damaging Het
Other mutations in Olfr724
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02811:Olfr724 APN 14 49960133 utr 3 prime probably benign
R0829:Olfr724 UTSW 14 49961046 missense probably benign 0.03
R1513:Olfr724 UTSW 14 49961101 critical splice acceptor site probably null
R2016:Olfr724 UTSW 14 49960502 missense probably benign 0.00
R2936:Olfr724 UTSW 14 49960154 missense probably benign 0.03
R3082:Olfr724 UTSW 14 49960704 missense probably damaging 1.00
R3738:Olfr724 UTSW 14 49960556 missense possibly damaging 0.60
R4772:Olfr724 UTSW 14 49960995 small deletion probably benign
R4839:Olfr724 UTSW 14 49960189 missense probably benign 0.41
R5362:Olfr724 UTSW 14 49960529 missense possibly damaging 0.95
R5695:Olfr724 UTSW 14 49960623 missense probably benign 0.00
R6187:Olfr724 UTSW 14 49961069 start codon destroyed probably null 0.99
R7371:Olfr724 UTSW 14 49961106 splice site probably null
R7611:Olfr724 UTSW 14 49960911 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCCAGGTTTTATATGGTCACTGTAG -3'
(R):5'- GCACAAATCACCTGGCAGTC -3'

Sequencing Primer
(F):5'- GTTGGTTCAATGAAAATTTTTCTTCG -3'
(R):5'- ACCTGGCAGTCTCTCCAAG -3'
Posted On2016-03-01