Incidental Mutation 'R4830:Esd'
ID372761
Institutional Source Beutler Lab
Gene Symbol Esd
Ensembl Gene ENSMUSG00000021996
Gene Nameesterase D/formylglutathione hydrolase
SynonymsEs10, Es-10, Esd
MMRRC Submission 042446-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R4830 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location74732297-74750765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74741160 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 54 (L54S)
Ref Sequence ENSEMBL: ENSMUSP00000135063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022573] [ENSMUST00000175712] [ENSMUST00000175887] [ENSMUST00000176957] [ENSMUST00000177137] [ENSMUST00000177181] [ENSMUST00000177283]
Predicted Effect probably damaging
Transcript: ENSMUST00000022573
AA Change: L54S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022573
Gene: ENSMUSG00000021996
AA Change: L54S

DomainStartEndE-ValueType
Pfam:Esterase 23 275 8.1e-74 PFAM
Pfam:Chlorophyllase2 29 184 2.7e-8 PFAM
Pfam:Esterase_phd 30 231 1e-7 PFAM
Pfam:Abhydrolase_5 48 261 4.6e-9 PFAM
Pfam:Peptidase_S9 102 282 2.2e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175712
AA Change: L54S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134932
Gene: ENSMUSG00000021996
AA Change: L54S

DomainStartEndE-ValueType
Pfam:Esterase 23 131 4.5e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175887
AA Change: L54S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135244
Gene: ENSMUSG00000021996
AA Change: L54S

DomainStartEndE-ValueType
Pfam:Esterase 23 242 1.3e-57 PFAM
Pfam:Chlorophyllase2 29 186 2.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176484
Predicted Effect unknown
Transcript: ENSMUST00000176726
AA Change: L5S
Predicted Effect probably damaging
Transcript: ENSMUST00000176957
AA Change: L67S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135394
Gene: ENSMUSG00000021996
AA Change: L67S

DomainStartEndE-ValueType
Pfam:AXE1 26 198 1e-7 PFAM
Pfam:Esterase 36 288 6.6e-74 PFAM
Pfam:Abhydrolase_5 61 274 7.1e-9 PFAM
Pfam:Peptidase_S9 116 295 2.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177137
AA Change: L54S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135818
Gene: ENSMUSG00000021996
AA Change: L54S

DomainStartEndE-ValueType
Pfam:Esterase 23 259 1.4e-68 PFAM
Pfam:Chlorophyllase2 29 184 2.2e-8 PFAM
Pfam:Esterase_phd 30 231 7.9e-8 PFAM
Pfam:Abhydrolase_5 48 247 5.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177181
AA Change: L54S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135035
Gene: ENSMUSG00000021996
AA Change: L54S

DomainStartEndE-ValueType
Pfam:Esterase 23 261 2e-68 PFAM
Pfam:Chlorophyllase2 29 184 2.3e-8 PFAM
Pfam:Esterase_phd 30 231 8.4e-8 PFAM
Pfam:Abhydrolase_5 48 248 5.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177283
AA Change: L54S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135063
Gene: ENSMUSG00000021996
AA Change: L54S

DomainStartEndE-ValueType
Pfam:AXE1 16 185 1.1e-7 PFAM
Pfam:Esterase 23 247 1e-67 PFAM
Pfam:Chlorophyllase2 29 184 1.9e-8 PFAM
Pfam:Esterase_phd 30 231 2.5e-8 PFAM
Pfam:Abhydrolase_5 48 239 5.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177445
Meta Mutation Damage Score 0.9651 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (71/73)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 C A 3: 121,760,284 G643V probably damaging Het
Adamtsl1 A G 4: 86,356,382 E1225G probably damaging Het
Agbl5 G A 5: 30,890,715 R111H probably damaging Het
Ankle2 A C 5: 110,242,013 K446Q probably damaging Het
Boc A C 16: 44,490,157 M800R probably damaging Het
Ccnt1 A T 15: 98,543,451 N645K probably damaging Het
Cd93 G A 2: 148,443,379 Q16* probably null Het
Cpsf4l G T 11: 113,709,502 probably benign Het
Cuzd1 T A 7: 131,318,054 D111V probably damaging Het
Dab2 T C 15: 6,427,527 C232R probably benign Het
Dmpk A T 7: 19,087,528 Y237F probably damaging Het
Dnah6 T A 6: 73,044,762 T3526S possibly damaging Het
Dock2 T C 11: 34,273,767 probably null Het
Dsp G A 13: 38,192,864 V1542I probably benign Het
Dst T A 1: 34,198,505 probably null Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Gm3604 A T 13: 62,369,043 N500K probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grhl2 T A 15: 37,335,659 probably null Het
Gsto1 C T 19: 47,864,391 R222C probably benign Het
H2afy2 C T 10: 61,739,353 D355N possibly damaging Het
Inpp4a T A 1: 37,371,780 M343K probably damaging Het
Itpripl2 T C 7: 118,491,057 Q93R probably benign Het
Jakmip2 G A 18: 43,567,143 T450I probably benign Het
Kdm6b A T 11: 69,403,794 I1186N unknown Het
Kif1a T C 1: 93,021,209 probably null Het
Klhl20 T C 1: 161,098,376 K434R probably benign Het
Lemd3 T C 10: 120,931,948 D697G probably damaging Het
Lipo1 A G 19: 33,776,587 S383P probably damaging Het
Ltn1 C A 16: 87,379,694 K1741N probably damaging Het
Lvrn A T 18: 46,905,351 T991S probably damaging Het
Mast3 C A 8: 70,788,915 R151L possibly damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myoz1 T C 14: 20,655,309 K14E probably damaging Het
Neb G T 2: 52,192,520 Q5450K probably damaging Het
Nedd1 T A 10: 92,686,258 N639I probably damaging Het
Nlrp4e A T 7: 23,336,740 N673Y probably benign Het
Nop53 C T 7: 15,942,204 R190Q probably damaging Het
Notch4 T C 17: 34,570,118 Y468H probably damaging Het
Obscn T C 11: 59,067,607 T3507A probably damaging Het
Olfr724 T C 14: 49,960,224 N283D probably damaging Het
Opn5 T C 17: 42,611,296 H5R probably benign Het
Patl1 T C 19: 11,925,151 M349T probably benign Het
Phactr3 A G 2: 178,284,018 N362S probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Rapgef5 G A 12: 117,756,074 R579Q probably damaging Het
Rgl1 T C 1: 152,554,330 D234G probably benign Het
Serpinb3a C T 1: 107,048,586 E122K probably benign Het
Slc22a15 T C 3: 101,875,603 probably benign Het
Slc25a12 A T 2: 71,296,805 V344E probably damaging Het
Slc43a2 T C 11: 75,543,293 L99P probably damaging Het
Smim27 G T 4: 40,269,719 probably null Het
Smtn A G 11: 3,520,736 probably benign Het
Szt2 A T 4: 118,369,248 Y3001N unknown Het
Tgfbr3 G T 5: 107,109,719 P825T probably damaging Het
Tnpo3 T C 6: 29,568,938 T472A probably benign Het
Trf T A 9: 103,227,915 D66V probably damaging Het
Vmn1r124 A G 7: 21,259,699 C307R probably damaging Het
Vps13b T A 15: 35,452,224 F656Y possibly damaging Het
Zic1 G T 9: 91,362,531 S358R probably damaging Het
Other mutations in Esd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Esd APN 14 74736027 missense probably damaging 1.00
IGL00534:Esd APN 14 74738461 missense probably damaging 0.99
IGL00904:Esd APN 14 74749688 makesense probably null
IGL01645:Esd APN 14 74749719 missense probably benign 0.00
IGL03117:Esd APN 14 74741246 missense probably damaging 1.00
R0766:Esd UTSW 14 74742121 missense probably damaging 1.00
R0939:Esd UTSW 14 74736027 missense probably damaging 1.00
R1862:Esd UTSW 14 74742074 missense probably damaging 1.00
R1892:Esd UTSW 14 74749673 missense probably damaging 0.96
R3922:Esd UTSW 14 74743227 missense probably benign 0.00
R4580:Esd UTSW 14 74742077 missense possibly damaging 0.55
R4969:Esd UTSW 14 74744713 missense possibly damaging 0.76
R5211:Esd UTSW 14 74741192 missense probably damaging 1.00
R5335:Esd UTSW 14 74742113 missense probably damaging 0.99
R5810:Esd UTSW 14 74745611 missense probably damaging 1.00
R7024:Esd UTSW 14 74744662 missense probably damaging 1.00
R7759:Esd UTSW 14 74745567 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTTTGGGTTCACCTCAAGCG -3'
(R):5'- CTGATGCTGCTCATATGACCAAAAG -3'

Sequencing Primer
(F):5'- ACCTCAAGCGTCGTTGCTAG -3'
(R):5'- TGCTGCTCATATGACCAAAAGATCAC -3'
Posted On2016-03-01