Incidental Mutation 'R4830:Dab2'
ID372762
Institutional Source Beutler Lab
Gene Symbol Dab2
Ensembl Gene ENSMUSG00000022150
Gene Namedisabled 2, mitogen-responsive phosphoprotein
Synonyms5730435J12Rik, p96, D630005B22Rik, D15Wsu122e
MMRRC Submission 042446-MU
Accession Numbers

Genbank: NM_023118, NM_001008702, MGI: 109175

Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R4830 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location6299788-6440712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6427527 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 232 (C232R)
Ref Sequence ENSEMBL: ENSMUSP00000124478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078019] [ENSMUST00000080880] [ENSMUST00000110663] [ENSMUST00000110664] [ENSMUST00000160134] [ENSMUST00000161040] [ENSMUST00000161812]
Predicted Effect probably benign
Transcript: ENSMUST00000078019
SMART Domains Protein: ENSMUSP00000077166
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 270 288 N/A INTRINSIC
low complexity region 292 306 N/A INTRINSIC
low complexity region 335 355 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
PDB:3H8D|H 465 493 2e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000080880
SMART Domains Protein: ENSMUSP00000079689
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 488 506 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 553 573 N/A INTRINSIC
low complexity region 596 612 N/A INTRINSIC
PDB:3H8D|H 683 711 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110663
SMART Domains Protein: ENSMUSP00000106291
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 270 288 N/A INTRINSIC
low complexity region 292 306 N/A INTRINSIC
low complexity region 335 355 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
PDB:3H8D|H 465 493 2e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110664
SMART Domains Protein: ENSMUSP00000106292
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 467 485 N/A INTRINSIC
low complexity region 489 503 N/A INTRINSIC
low complexity region 532 552 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
PDB:3H8D|H 662 690 3e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159552
Predicted Effect probably benign
Transcript: ENSMUST00000160134
SMART Domains Protein: ENSMUSP00000125021
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161040
AA Change: C232R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124478
Gene: ENSMUSG00000022150
AA Change: C232R

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161558
Predicted Effect probably benign
Transcript: ENSMUST00000161812
SMART Domains Protein: ENSMUSP00000124589
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 249 267 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
low complexity region 314 334 N/A INTRINSIC
low complexity region 357 373 N/A INTRINSIC
PDB:3H8D|H 444 472 2e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000163082
SMART Domains Protein: ENSMUSP00000124996
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
Blast:PTB 2 59 1e-33 BLAST
PDB:1P3R|C 2 59 2e-34 PDB
SCOP:d1ddma_ 3 59 9e-12 SMART
low complexity region 60 79 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
low complexity region 378 392 N/A INTRINSIC
low complexity region 421 441 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
PDB:3H8D|H 551 579 3e-12 PDB
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitogen-responsive phosphoprotein. It is expressed in normal ovarian epithelial cells, but is down-regulated or absent from ovarian carcinoma cell lines, suggesting its role as a tumor suppressor. This protein binds to the SH3 domains of GRB2, an adaptor protein that couples tyrosine kinase receptors to SOS (a guanine nucleotide exchange factor for Ras), via its C-terminal proline-rich sequences, and may thus modulate growth factor/Ras pathways by competing with SOS for binding to GRB2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mutants exhibit abnormal primitive endoderm structure and/or function, lack a proamniotic cavity and die prior to embryonic day 9.5. A conditional mutant survives, but shows kidney proximal tubule abnormality. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 C A 3: 121,760,284 G643V probably damaging Het
Adamtsl1 A G 4: 86,356,382 E1225G probably damaging Het
Agbl5 G A 5: 30,890,715 R111H probably damaging Het
Ankle2 A C 5: 110,242,013 K446Q probably damaging Het
Boc A C 16: 44,490,157 M800R probably damaging Het
Ccnt1 A T 15: 98,543,451 N645K probably damaging Het
Cd93 G A 2: 148,443,379 Q16* probably null Het
Cpsf4l G T 11: 113,709,502 probably benign Het
Cuzd1 T A 7: 131,318,054 D111V probably damaging Het
Dmpk A T 7: 19,087,528 Y237F probably damaging Het
Dnah6 T A 6: 73,044,762 T3526S possibly damaging Het
Dock2 T C 11: 34,273,767 probably null Het
Dsp G A 13: 38,192,864 V1542I probably benign Het
Dst T A 1: 34,198,505 probably null Het
Esd T C 14: 74,741,160 L54S probably damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Gm3604 A T 13: 62,369,043 N500K probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grhl2 T A 15: 37,335,659 probably null Het
Gsto1 C T 19: 47,864,391 R222C probably benign Het
H2afy2 C T 10: 61,739,353 D355N possibly damaging Het
Inpp4a T A 1: 37,371,780 M343K probably damaging Het
Itpripl2 T C 7: 118,491,057 Q93R probably benign Het
Jakmip2 G A 18: 43,567,143 T450I probably benign Het
Kdm6b A T 11: 69,403,794 I1186N unknown Het
Kif1a T C 1: 93,021,209 probably null Het
Klhl20 T C 1: 161,098,376 K434R probably benign Het
Lemd3 T C 10: 120,931,948 D697G probably damaging Het
Lipo1 A G 19: 33,776,587 S383P probably damaging Het
Ltn1 C A 16: 87,379,694 K1741N probably damaging Het
Lvrn A T 18: 46,905,351 T991S probably damaging Het
Mast3 C A 8: 70,788,915 R151L possibly damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myoz1 T C 14: 20,655,309 K14E probably damaging Het
Neb G T 2: 52,192,520 Q5450K probably damaging Het
Nedd1 T A 10: 92,686,258 N639I probably damaging Het
Nlrp4e A T 7: 23,336,740 N673Y probably benign Het
Nop53 C T 7: 15,942,204 R190Q probably damaging Het
Notch4 T C 17: 34,570,118 Y468H probably damaging Het
Obscn T C 11: 59,067,607 T3507A probably damaging Het
Olfr724 T C 14: 49,960,224 N283D probably damaging Het
Opn5 T C 17: 42,611,296 H5R probably benign Het
Patl1 T C 19: 11,925,151 M349T probably benign Het
Phactr3 A G 2: 178,284,018 N362S probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Rapgef5 G A 12: 117,756,074 R579Q probably damaging Het
Rgl1 T C 1: 152,554,330 D234G probably benign Het
Serpinb3a C T 1: 107,048,586 E122K probably benign Het
Slc22a15 T C 3: 101,875,603 probably benign Het
Slc25a12 A T 2: 71,296,805 V344E probably damaging Het
Slc43a2 T C 11: 75,543,293 L99P probably damaging Het
Smim27 G T 4: 40,269,719 probably null Het
Smtn A G 11: 3,520,736 probably benign Het
Szt2 A T 4: 118,369,248 Y3001N unknown Het
Tgfbr3 G T 5: 107,109,719 P825T probably damaging Het
Tnpo3 T C 6: 29,568,938 T472A probably benign Het
Trf T A 9: 103,227,915 D66V probably damaging Het
Vmn1r124 A G 7: 21,259,699 C307R probably damaging Het
Vps13b T A 15: 35,452,224 F656Y possibly damaging Het
Zic1 G T 9: 91,362,531 S358R probably damaging Het
Other mutations in Dab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Dab2 APN 15 6429825 missense probably benign 0.00
IGL00731:Dab2 APN 15 6435710 missense possibly damaging 0.95
IGL02382:Dab2 APN 15 6436987 missense possibly damaging 0.62
IGL02598:Dab2 APN 15 6429366 missense probably damaging 0.97
IGL03054:Dab2 APN 15 6418226 unclassified probably benign
IGL03093:Dab2 APN 15 6436411 missense probably damaging 1.00
IGL03369:Dab2 APN 15 6435309 missense possibly damaging 0.64
IGL03372:Dab2 APN 15 6429549 missense probably damaging 0.99
R0157:Dab2 UTSW 15 6429827 missense probably benign 0.00
R0326:Dab2 UTSW 15 6418316 missense probably damaging 1.00
R0488:Dab2 UTSW 15 6424654 missense probably damaging 1.00
R0552:Dab2 UTSW 15 6435414 missense possibly damaging 0.65
R0938:Dab2 UTSW 15 6435384 missense probably benign 0.04
R1433:Dab2 UTSW 15 6429938 missense probably damaging 1.00
R1635:Dab2 UTSW 15 6429870 missense possibly damaging 0.80
R1713:Dab2 UTSW 15 6429701 missense possibly damaging 0.94
R1757:Dab2 UTSW 15 6330452 intron probably benign
R1800:Dab2 UTSW 15 6435467 missense probably benign
R1837:Dab2 UTSW 15 6336476 intron probably benign
R1999:Dab2 UTSW 15 6416917 missense probably benign 0.32
R2050:Dab2 UTSW 15 6435215 missense possibly damaging 0.47
R2117:Dab2 UTSW 15 6435615 missense probably damaging 1.00
R2129:Dab2 UTSW 15 6336383 nonsense probably null
R2150:Dab2 UTSW 15 6416917 missense probably benign 0.32
R2329:Dab2 UTSW 15 6429563 missense possibly damaging 0.80
R2338:Dab2 UTSW 15 6435252 missense possibly damaging 0.62
R2680:Dab2 UTSW 15 6436993 missense possibly damaging 0.89
R3978:Dab2 UTSW 15 6435163 critical splice acceptor site probably null
R3979:Dab2 UTSW 15 6435163 critical splice acceptor site probably null
R3980:Dab2 UTSW 15 6435163 critical splice acceptor site probably null
R4551:Dab2 UTSW 15 6435294 missense probably damaging 0.97
R4795:Dab2 UTSW 15 6429611 missense probably benign 0.16
R4829:Dab2 UTSW 15 6424681 missense probably damaging 1.00
R4832:Dab2 UTSW 15 6336599 intron probably null
R5168:Dab2 UTSW 15 6336443 intron probably benign
R5620:Dab2 UTSW 15 6418315 missense probably damaging 0.98
R5996:Dab2 UTSW 15 6435311 nonsense probably null
R6159:Dab2 UTSW 15 6436460 missense possibly damaging 0.93
R6998:Dab2 UTSW 15 6424649 missense possibly damaging 0.49
R7002:Dab2 UTSW 15 6435365 missense probably benign 0.01
R7040:Dab2 UTSW 15 6422251 missense probably damaging 1.00
R7138:Dab2 UTSW 15 6429299 missense probably benign 0.24
R7448:Dab2 UTSW 15 6422266 missense probably damaging 1.00
R7548:Dab2 UTSW 15 6429918 missense possibly damaging 0.80
R8062:Dab2 UTSW 15 6427341 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCTTGCTGAAGTGACTTGC -3'
(R):5'- TGAATGGGAGACTTCTTAATGAGGG -3'

Sequencing Primer
(F):5'- ACTTTCACAGCTGTCTGAAGG -3'
(R):5'- GACTTCTTAATGAGGGGATTTTAAGC -3'
Posted On2016-03-01