Incidental Mutation 'R4830:Opn5'
ID 372768
Institutional Source Beutler Lab
Gene Symbol Opn5
Ensembl Gene ENSMUSG00000043972
Gene Name opsin 5
Synonyms TMEM13, Gpr136, Neuropsin, PGR12
MMRRC Submission 042446-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.231) question?
Stock # R4830 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 42867674-42922286 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 42922187 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 5 (H5R)
Ref Sequence ENSEMBL: ENSMUSP00000063542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068355]
AlphaFold Q6VZZ7
Predicted Effect probably benign
Transcript: ENSMUST00000068355
AA Change: H5R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000063542
Gene: ENSMUSG00000043972
AA Change: H5R

DomainStartEndE-ValueType
Pfam:7tm_1 50 306 3.4e-41 PFAM
Meta Mutation Damage Score 0.0625 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Opsins are members of the guanine nucleotide-binding protein (G protein)-coupled receptor superfamily. This opsin gene is expressed in the eye, brain, testes, and spinal cord. This gene belongs to the seven-exon subfamily of mammalian opsin genes that includes peropsin (RRH) and retinal G protein coupled receptor (RGR). Like these other seven-exon opsin genes, this family member may encode a protein with photoisomerase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele fail to exhibit light/dark entrainment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 C A 3: 121,553,933 (GRCm39) G643V probably damaging Het
Adamtsl1 A G 4: 86,274,619 (GRCm39) E1225G probably damaging Het
Agbl5 G A 5: 31,048,059 (GRCm39) R111H probably damaging Het
Ankle2 A C 5: 110,389,879 (GRCm39) K446Q probably damaging Het
Boc A C 16: 44,310,520 (GRCm39) M800R probably damaging Het
Ccnt1 A T 15: 98,441,332 (GRCm39) N645K probably damaging Het
Cd93 G A 2: 148,285,299 (GRCm39) Q16* probably null Het
Cpsf4l G T 11: 113,600,328 (GRCm39) probably benign Het
Cuzd1 T A 7: 130,919,783 (GRCm39) D111V probably damaging Het
Dab2 T C 15: 6,457,008 (GRCm39) C232R probably benign Het
Dmpk A T 7: 18,821,453 (GRCm39) Y237F probably damaging Het
Dnah6 T A 6: 73,021,745 (GRCm39) T3526S possibly damaging Het
Dock2 T C 11: 34,223,767 (GRCm39) probably null Het
Dsp G A 13: 38,376,840 (GRCm39) V1542I probably benign Het
Dst T A 1: 34,237,586 (GRCm39) probably null Het
Esd T C 14: 74,978,600 (GRCm39) L54S probably damaging Het
Exd1 C T 2: 119,350,807 (GRCm39) A485T probably benign Het
Gm3604 A T 13: 62,516,857 (GRCm39) N500K probably damaging Het
Grhl2 T A 15: 37,335,903 (GRCm39) probably null Het
Gsto1 C T 19: 47,852,830 (GRCm39) R222C probably benign Het
Inpp4a T A 1: 37,410,861 (GRCm39) M343K probably damaging Het
Itpripl2 T C 7: 118,090,280 (GRCm39) Q93R probably benign Het
Jakmip2 G A 18: 43,700,208 (GRCm39) T450I probably benign Het
Kdm6b A T 11: 69,294,620 (GRCm39) I1186N unknown Het
Kif1a T C 1: 92,948,931 (GRCm39) probably null Het
Klhl20 T C 1: 160,925,946 (GRCm39) K434R probably benign Het
Lemd3 T C 10: 120,767,853 (GRCm39) D697G probably damaging Het
Lipo3 A G 19: 33,753,987 (GRCm39) S383P probably damaging Het
Ltn1 C A 16: 87,176,582 (GRCm39) K1741N probably damaging Het
Lvrn A T 18: 47,038,418 (GRCm39) T991S probably damaging Het
Macroh2a2 C T 10: 61,575,132 (GRCm39) D355N possibly damaging Het
Mast3 C A 8: 71,241,559 (GRCm39) R151L possibly damaging Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Myoz1 T C 14: 20,705,377 (GRCm39) K14E probably damaging Het
Neb G T 2: 52,082,532 (GRCm39) Q5450K probably damaging Het
Nedd1 T A 10: 92,522,120 (GRCm39) N639I probably damaging Het
Nlrp4e A T 7: 23,036,165 (GRCm39) N673Y probably benign Het
Nop53 C T 7: 15,676,129 (GRCm39) R190Q probably damaging Het
Notch4 T C 17: 34,789,092 (GRCm39) Y468H probably damaging Het
Obscn T C 11: 58,958,433 (GRCm39) T3507A probably damaging Het
Or4l15 T C 14: 50,197,681 (GRCm39) N283D probably damaging Het
Patl1 T C 19: 11,902,515 (GRCm39) M349T probably benign Het
Phactr3 A G 2: 177,925,811 (GRCm39) N362S probably damaging Het
Pirb C T 7: 3,720,602 (GRCm39) G299S probably benign Het
Rapgef5 G A 12: 117,719,809 (GRCm39) R579Q probably damaging Het
Rgl1 T C 1: 152,430,081 (GRCm39) D234G probably benign Het
Serpinb3a C T 1: 106,976,316 (GRCm39) E122K probably benign Het
Slc22a15 T C 3: 101,782,919 (GRCm39) probably benign Het
Slc25a12 A T 2: 71,127,149 (GRCm39) V344E probably damaging Het
Slc43a2 T C 11: 75,434,119 (GRCm39) L99P probably damaging Het
Smim27 G T 4: 40,269,719 (GRCm39) probably null Het
Smtn A G 11: 3,470,736 (GRCm39) probably benign Het
Szt2 A T 4: 118,226,445 (GRCm39) Y3001N unknown Het
Tgfbr3 G T 5: 107,257,585 (GRCm39) P825T probably damaging Het
Tnpo3 T C 6: 29,568,937 (GRCm39) T472A probably benign Het
Trf T A 9: 103,105,114 (GRCm39) D66V probably damaging Het
Vmn1r124 A G 7: 20,993,624 (GRCm39) C307R probably damaging Het
Vps13b T A 15: 35,452,370 (GRCm39) F656Y possibly damaging Het
Zic1 G T 9: 91,244,584 (GRCm39) S358R probably damaging Het
Other mutations in Opn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Opn5 APN 17 42,922,119 (GRCm39) missense probably damaging 1.00
IGL01372:Opn5 APN 17 42,891,435 (GRCm39) splice site probably null
IGL01554:Opn5 APN 17 42,918,089 (GRCm39) missense probably damaging 0.99
IGL02363:Opn5 APN 17 42,868,382 (GRCm39) missense probably benign
IGL02421:Opn5 APN 17 42,907,446 (GRCm39) splice site probably benign
IGL02720:Opn5 APN 17 42,907,517 (GRCm39) missense probably damaging 1.00
K7371:Opn5 UTSW 17 42,891,522 (GRCm39) missense probably damaging 1.00
R0063:Opn5 UTSW 17 42,907,517 (GRCm39) missense probably damaging 1.00
R0220:Opn5 UTSW 17 42,907,495 (GRCm39) missense probably benign 0.04
R0505:Opn5 UTSW 17 42,903,844 (GRCm39) missense possibly damaging 0.88
R0971:Opn5 UTSW 17 42,922,218 (GRCm39) splice site probably null
R2035:Opn5 UTSW 17 42,918,052 (GRCm39) missense probably damaging 0.97
R4723:Opn5 UTSW 17 42,918,091 (GRCm39) missense probably damaging 1.00
R4874:Opn5 UTSW 17 42,891,610 (GRCm39) missense probably damaging 1.00
R4955:Opn5 UTSW 17 42,922,129 (GRCm39) missense probably damaging 1.00
R5813:Opn5 UTSW 17 42,903,897 (GRCm39) missense probably damaging 0.99
R5924:Opn5 UTSW 17 42,922,199 (GRCm39) start codon destroyed probably null 0.95
R6478:Opn5 UTSW 17 42,891,640 (GRCm39) missense probably benign 0.06
R7831:Opn5 UTSW 17 42,891,510 (GRCm39) missense probably null 0.85
R9182:Opn5 UTSW 17 42,903,890 (GRCm39) missense probably damaging 1.00
R9267:Opn5 UTSW 17 42,903,793 (GRCm39) missense probably damaging 1.00
R9802:Opn5 UTSW 17 42,903,582 (GRCm39) missense possibly damaging 0.87
Z1177:Opn5 UTSW 17 42,907,490 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTGTCACAATGCCAATTCAC -3'
(R):5'- CGGTGAACATCTCTCCACTAGG -3'

Sequencing Primer
(F):5'- TGCTAATACCCACGTACTTATCAG -3'
(R):5'- TAGGTACCAATCACCTGTGGGAC -3'
Posted On 2016-03-01