Incidental Mutation 'R4830:Lvrn'
ID372770
Institutional Source Beutler Lab
Gene Symbol Lvrn
Ensembl Gene ENSMUSG00000024481
Gene Namelaeverin
Synonyms4833403I15Rik, Aqpep
MMRRC Submission 042446-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock #R4830 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location46850039-46905446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46905351 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 991 (T991S)
Ref Sequence ENSEMBL: ENSMUSP00000025358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025358]
Predicted Effect probably damaging
Transcript: ENSMUST00000025358
AA Change: T991S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025358
Gene: ENSMUSG00000024481
AA Change: T991S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Peptidase_M1 94 504 1.6e-110 PFAM
Pfam:ERAP1_C 645 968 2.5e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178659
Meta Mutation Damage Score 0.2152 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (71/73)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 C A 3: 121,760,284 G643V probably damaging Het
Adamtsl1 A G 4: 86,356,382 E1225G probably damaging Het
Agbl5 G A 5: 30,890,715 R111H probably damaging Het
Ankle2 A C 5: 110,242,013 K446Q probably damaging Het
Boc A C 16: 44,490,157 M800R probably damaging Het
Ccnt1 A T 15: 98,543,451 N645K probably damaging Het
Cd93 G A 2: 148,443,379 Q16* probably null Het
Cpsf4l G T 11: 113,709,502 probably benign Het
Cuzd1 T A 7: 131,318,054 D111V probably damaging Het
Dab2 T C 15: 6,427,527 C232R probably benign Het
Dmpk A T 7: 19,087,528 Y237F probably damaging Het
Dnah6 T A 6: 73,044,762 T3526S possibly damaging Het
Dock2 T C 11: 34,273,767 probably null Het
Dsp G A 13: 38,192,864 V1542I probably benign Het
Dst T A 1: 34,198,505 probably null Het
Esd T C 14: 74,741,160 L54S probably damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Gm3604 A T 13: 62,369,043 N500K probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grhl2 T A 15: 37,335,659 probably null Het
Gsto1 C T 19: 47,864,391 R222C probably benign Het
H2afy2 C T 10: 61,739,353 D355N possibly damaging Het
Inpp4a T A 1: 37,371,780 M343K probably damaging Het
Itpripl2 T C 7: 118,491,057 Q93R probably benign Het
Jakmip2 G A 18: 43,567,143 T450I probably benign Het
Kdm6b A T 11: 69,403,794 I1186N unknown Het
Kif1a T C 1: 93,021,209 probably null Het
Klhl20 T C 1: 161,098,376 K434R probably benign Het
Lemd3 T C 10: 120,931,948 D697G probably damaging Het
Lipo1 A G 19: 33,776,587 S383P probably damaging Het
Ltn1 C A 16: 87,379,694 K1741N probably damaging Het
Mast3 C A 8: 70,788,915 R151L possibly damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myoz1 T C 14: 20,655,309 K14E probably damaging Het
Neb G T 2: 52,192,520 Q5450K probably damaging Het
Nedd1 T A 10: 92,686,258 N639I probably damaging Het
Nlrp4e A T 7: 23,336,740 N673Y probably benign Het
Nop53 C T 7: 15,942,204 R190Q probably damaging Het
Notch4 T C 17: 34,570,118 Y468H probably damaging Het
Obscn T C 11: 59,067,607 T3507A probably damaging Het
Olfr724 T C 14: 49,960,224 N283D probably damaging Het
Opn5 T C 17: 42,611,296 H5R probably benign Het
Patl1 T C 19: 11,925,151 M349T probably benign Het
Phactr3 A G 2: 178,284,018 N362S probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Rapgef5 G A 12: 117,756,074 R579Q probably damaging Het
Rgl1 T C 1: 152,554,330 D234G probably benign Het
Serpinb3a C T 1: 107,048,586 E122K probably benign Het
Slc22a15 T C 3: 101,875,603 probably benign Het
Slc25a12 A T 2: 71,296,805 V344E probably damaging Het
Slc43a2 T C 11: 75,543,293 L99P probably damaging Het
Smim27 G T 4: 40,269,719 probably null Het
Smtn A G 11: 3,520,736 probably benign Het
Szt2 A T 4: 118,369,248 Y3001N unknown Het
Tgfbr3 G T 5: 107,109,719 P825T probably damaging Het
Tnpo3 T C 6: 29,568,938 T472A probably benign Het
Trf T A 9: 103,227,915 D66V probably damaging Het
Vmn1r124 A G 7: 21,259,699 C307R probably damaging Het
Vps13b T A 15: 35,452,224 F656Y possibly damaging Het
Zic1 G T 9: 91,362,531 S358R probably damaging Het
Other mutations in Lvrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Lvrn APN 18 46864666 splice site probably benign
IGL01532:Lvrn APN 18 46900484 missense probably damaging 1.00
IGL02430:Lvrn APN 18 46894730 missense probably benign 0.03
IGL02573:Lvrn APN 18 46876949 missense probably damaging 0.98
IGL02592:Lvrn APN 18 46850591 missense probably damaging 1.00
IGL02754:Lvrn APN 18 46890904 nonsense probably null
IGL03089:Lvrn APN 18 46880709 missense probably damaging 0.99
IGL03209:Lvrn APN 18 46889498 missense probably benign 0.00
IGL03333:Lvrn APN 18 46864664 splice site probably benign
IGL03098:Lvrn UTSW 18 46881410 critical splice acceptor site probably null
R0319:Lvrn UTSW 18 46864753 missense probably damaging 1.00
R0391:Lvrn UTSW 18 46850466 missense probably benign 0.01
R0398:Lvrn UTSW 18 46880693 missense probably benign 0.06
R0432:Lvrn UTSW 18 46905299 missense possibly damaging 0.94
R0456:Lvrn UTSW 18 46864816 critical splice donor site probably null
R1458:Lvrn UTSW 18 46882385 splice site probably benign
R1612:Lvrn UTSW 18 46894703 missense probably damaging 0.99
R1935:Lvrn UTSW 18 46878320 missense probably benign 0.10
R1936:Lvrn UTSW 18 46878320 missense probably benign 0.10
R1959:Lvrn UTSW 18 46894717 missense probably damaging 1.00
R2000:Lvrn UTSW 18 46905307 missense probably benign 0.04
R2022:Lvrn UTSW 18 46866436 missense possibly damaging 0.81
R2106:Lvrn UTSW 18 46878289 missense probably damaging 1.00
R2197:Lvrn UTSW 18 46878342 missense probably benign 0.03
R2371:Lvrn UTSW 18 46878163 intron probably null
R4125:Lvrn UTSW 18 46876969 missense possibly damaging 0.53
R4606:Lvrn UTSW 18 46864765 missense possibly damaging 0.92
R4866:Lvrn UTSW 18 46893701 missense probably damaging 1.00
R4900:Lvrn UTSW 18 46893701 missense probably damaging 1.00
R4900:Lvrn UTSW 18 46881412 missense probably damaging 1.00
R4924:Lvrn UTSW 18 46894725 missense probably damaging 1.00
R4948:Lvrn UTSW 18 46880736 missense probably damaging 1.00
R5167:Lvrn UTSW 18 46880747 missense probably damaging 0.99
R5527:Lvrn UTSW 18 46873803 missense probably damaging 1.00
R5581:Lvrn UTSW 18 46890865 missense probably benign 0.17
R5615:Lvrn UTSW 18 46850328 missense possibly damaging 0.55
R5859:Lvrn UTSW 18 46893749 missense probably damaging 1.00
R6149:Lvrn UTSW 18 46884432 missense probably benign 0.10
R6183:Lvrn UTSW 18 46850685 missense probably benign 0.14
R6378:Lvrn UTSW 18 46894957 missense probably benign 0.00
R6838:Lvrn UTSW 18 46890880 missense possibly damaging 0.88
R6993:Lvrn UTSW 18 46882298 missense probably benign 0.18
R7017:Lvrn UTSW 18 46850678 missense probably benign 0.00
R7168:Lvrn UTSW 18 46881322 missense probably benign 0.29
R7190:Lvrn UTSW 18 46900503 missense probably benign 0.02
R7315:Lvrn UTSW 18 46876984 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TTGTGCCAGTGAGACGTCTG -3'
(R):5'- TCCTCAGCAAAGACGTGAAATC -3'

Sequencing Primer
(F):5'- CCAGTGAGACGTCTGGTGGTG -3'
(R):5'- TCAGGAAGGACACGACTCTG -3'
Posted On2016-03-01