Incidental Mutation 'R4831:Pikfyve'
ID 372778
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Name phosphoinositide kinase, FYVE type zinc finger containing
Synonyms PipkIII, Pip5k3, 5230400C17Rik
MMRRC Submission 042447-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4831 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 65225842-65317854 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65235900 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 191 (C191S)
Ref Sequence ENSEMBL: ENSMUSP00000095314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707] [ENSMUST00000185263] [ENSMUST00000190058]
AlphaFold Q9Z1T6
Predicted Effect probably damaging
Transcript: ENSMUST00000081154
AA Change: C202S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: C202S

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097707
AA Change: C191S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: C191S

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213081
Predicted Effect probably benign
Transcript: ENSMUST00000190058
SMART Domains Protein: ENSMUSP00000140204
Gene: ENSMUSG00000025949

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
Meta Mutation Damage Score 0.9627 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (96/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik C T 11: 69,791,403 (GRCm39) V59I possibly damaging Het
4930544M13Rik T G 13: 114,744,183 (GRCm39) noncoding transcript Het
Abca13 A T 11: 9,492,077 (GRCm39) K4373* probably null Het
Abtb2 A T 2: 103,513,820 (GRCm39) T410S probably benign Het
Adamts13 T C 2: 26,873,142 (GRCm39) probably null Het
Ahnak2 C G 12: 112,742,183 (GRCm39) D630H probably damaging Het
Aox3 T C 1: 58,191,725 (GRCm39) S426P probably damaging Het
Atxn10 C T 15: 85,271,260 (GRCm39) S266F probably benign Het
B4galnt4 G T 7: 140,647,634 (GRCm39) M407I probably damaging Het
B4galnt4 T A 7: 140,644,470 (GRCm39) probably null Het
Bclaf1 T A 10: 20,197,872 (GRCm39) probably benign Het
C4b C T 17: 34,955,864 (GRCm39) probably null Het
Cdc42bpg T C 19: 6,361,365 (GRCm39) F297S probably damaging Het
Cdh10 A T 15: 19,013,664 (GRCm39) T755S probably benign Het
Ceacam12 T A 7: 17,811,305 (GRCm39) probably null Het
Cfap65 C A 1: 74,956,454 (GRCm39) V1042F possibly damaging Het
Cfap77 T C 2: 28,875,844 (GRCm39) I89V probably benign Het
Cfh T C 1: 140,014,125 (GRCm39) D688G probably benign Het
Clip1 C G 5: 123,721,664 (GRCm39) A1182P probably damaging Het
Cyp2b10 T A 7: 25,614,921 (GRCm39) Y309* probably null Het
Dcaf5 T C 12: 80,385,858 (GRCm39) E756G probably benign Het
Dctn1 A T 6: 83,176,753 (GRCm39) Q1231L possibly damaging Het
Dennd1c T A 17: 57,373,428 (GRCm39) R682* probably null Het
Eml6 C A 11: 29,727,052 (GRCm39) E1319* probably null Het
Erap1 T C 13: 74,838,766 (GRCm39) I904T probably damaging Het
Eri1 A T 8: 35,943,673 (GRCm39) I207N possibly damaging Het
Farp1 G A 14: 121,514,469 (GRCm39) A933T probably damaging Het
Fcna T A 2: 25,515,353 (GRCm39) Q210L probably benign Het
Fhad1 A T 4: 141,643,378 (GRCm39) probably null Het
Fut8 T G 12: 77,440,603 (GRCm39) Y197D probably damaging Het
Garem1 G A 18: 21,262,825 (GRCm39) T663I probably benign Het
Gfm2 T C 13: 97,301,546 (GRCm39) S450P probably damaging Het
Gstk1 T G 6: 42,222,938 (GRCm39) probably benign Het
Helz2 C T 2: 180,879,210 (GRCm39) A803T probably damaging Het
Igsf9 T A 1: 172,319,455 (GRCm39) I280N probably damaging Het
Klhl10 A G 11: 100,336,669 (GRCm39) K219E probably benign Het
L3mbtl4 T A 17: 68,768,558 (GRCm39) V222D probably damaging Het
Lrrc9 A T 12: 72,546,453 (GRCm39) N1214Y probably damaging Het
Ltbp2 C T 12: 84,840,414 (GRCm39) E1051K possibly damaging Het
Mettl17 T C 14: 52,122,440 (GRCm39) F13S probably benign Het
Mettl24 C A 10: 40,559,413 (GRCm39) A21D possibly damaging Het
Mfsd6l T A 11: 68,447,331 (GRCm39) C61S probably benign Het
Mob4 T G 1: 55,191,899 (GRCm39) D204E probably benign Het
Mtus1 C G 8: 41,536,189 (GRCm39) R509T probably damaging Het
Nlrp4a T A 7: 26,149,844 (GRCm39) F484I possibly damaging Het
Nsrp1 T C 11: 76,941,444 (GRCm39) N88S probably benign Het
Odad2 G T 18: 7,222,564 (GRCm39) H568Q possibly damaging Het
Or10d5 C T 9: 39,861,408 (GRCm39) V220I probably benign Het
Or2g25 T A 17: 37,970,969 (GRCm39) H85L probably benign Het
Or51b6b T C 7: 103,309,678 (GRCm39) T260A probably benign Het
Or6c2 T A 10: 129,362,449 (GRCm39) Y118N probably damaging Het
Parg A G 14: 31,924,408 (GRCm39) N69S probably benign Het
Pcdh9 A C 14: 94,125,377 (GRCm39) N264K probably damaging Het
Pcdhb22 G T 18: 37,653,615 (GRCm39) L694F probably damaging Het
Pcnt T C 10: 76,248,335 (GRCm39) E928G probably damaging Het
Pdzk1 G A 3: 96,775,751 (GRCm39) G373D probably benign Het
Pea15a A G 1: 172,026,740 (GRCm39) I89T probably damaging Het
Phc1 T A 6: 122,313,964 (GRCm39) probably benign Het
Pitpnm1 T A 19: 4,158,130 (GRCm39) D573E probably damaging Het
Pld5 A G 1: 176,102,450 (GRCm39) probably benign Het
Plscr2 A T 9: 92,173,130 (GRCm39) N89I possibly damaging Het
Pm20d2 A C 4: 33,179,293 (GRCm39) N315K probably damaging Het
Pnpla1 T A 17: 29,097,518 (GRCm39) M228K probably benign Het
Prim2 T C 1: 33,709,217 (GRCm39) probably benign Het
Ralgapa2 A G 2: 146,246,987 (GRCm39) probably benign Het
Rgs22 G T 15: 36,050,294 (GRCm39) H719N probably benign Het
Ror2 C T 13: 53,272,880 (GRCm39) D250N probably damaging Het
Saal1 A G 7: 46,349,071 (GRCm39) V281A probably benign Het
Selenof A T 3: 144,296,411 (GRCm39) K94N probably damaging Het
Slamf9 T A 1: 172,304,831 (GRCm39) C148* probably null Het
Slc4a7 T C 14: 14,772,699 (GRCm38) probably null Het
Slco1a5 A G 6: 142,180,431 (GRCm39) I657T probably benign Het
St3gal2 A T 8: 111,684,480 (GRCm39) H46L probably benign Het
Sucnr1 T G 3: 59,994,069 (GRCm39) M199R probably damaging Het
Taok1 T A 11: 77,444,500 (GRCm39) E525V probably null Het
Tbc1d10c T A 19: 4,235,445 (GRCm39) E298V probably damaging Het
Tll2 T A 19: 41,118,951 (GRCm39) H259L probably damaging Het
Tpcn1 A T 5: 120,691,554 (GRCm39) F300Y probably damaging Het
Uba6 T A 5: 86,279,197 (GRCm39) I642L probably benign Het
Ubqln5 T A 7: 103,778,829 (GRCm39) probably benign Het
Vmn1r27 A T 6: 58,192,827 (GRCm39) L9Q possibly damaging Het
Vmn2r100 C T 17: 19,741,672 (GRCm39) T128I probably benign Het
Vmn2r109 C T 17: 20,761,494 (GRCm39) G621D probably benign Het
Vmn2r49 C T 7: 9,720,352 (GRCm39) D380N probably benign Het
Vps13a C T 19: 16,655,356 (GRCm39) V1891I probably benign Het
Wbp2 G T 11: 115,971,463 (GRCm39) Y147* probably null Het
Wdr46 T A 17: 34,160,810 (GRCm39) N191K probably benign Het
Wdr46 T C 17: 34,168,373 (GRCm39) probably benign Het
Wnt2 A C 6: 18,023,285 (GRCm39) F121L probably benign Het
Xpnpep1 T A 19: 53,003,053 (GRCm39) D100V probably benign Het
Xpo4 T C 14: 57,827,559 (GRCm39) Y879C probably damaging Het
Zswim4 A T 8: 84,938,948 (GRCm39) V978D probably damaging Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65,299,280 (GRCm39) critical splice donor site probably null
IGL01135:Pikfyve APN 1 65,290,794 (GRCm39) missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65,298,028 (GRCm39) nonsense probably null
IGL01759:Pikfyve APN 1 65,292,512 (GRCm39) missense probably benign 0.06
IGL01888:Pikfyve APN 1 65,262,799 (GRCm39) missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65,303,524 (GRCm39) missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65,277,703 (GRCm39) critical splice donor site probably null
IGL02119:Pikfyve APN 1 65,311,730 (GRCm39) missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65,285,556 (GRCm39) missense probably benign 0.13
IGL02207:Pikfyve APN 1 65,290,837 (GRCm39) critical splice donor site probably null
IGL02380:Pikfyve APN 1 65,295,180 (GRCm39) missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65,291,728 (GRCm39) missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65,283,663 (GRCm39) missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65,290,771 (GRCm39) missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65,303,535 (GRCm39) missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65,270,014 (GRCm39) critical splice donor site probably null
IGL02746:Pikfyve APN 1 65,273,431 (GRCm39) missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65,289,353 (GRCm39) nonsense probably null
IGL02890:Pikfyve APN 1 65,269,956 (GRCm39) missense probably benign 0.00
IGL03102:Pikfyve APN 1 65,291,626 (GRCm39) nonsense probably null
IGL03294:Pikfyve APN 1 65,286,226 (GRCm39) missense probably damaging 1.00
falcon UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
oompa UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
wonka UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65,242,075 (GRCm39) missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65,255,088 (GRCm39) splice site probably benign
R0196:Pikfyve UTSW 1 65,295,231 (GRCm39) missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65,302,064 (GRCm39) missense probably benign 0.41
R0319:Pikfyve UTSW 1 65,285,490 (GRCm39) missense probably benign 0.01
R0332:Pikfyve UTSW 1 65,303,558 (GRCm39) missense probably benign 0.02
R0389:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65,259,058 (GRCm39) missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65,292,682 (GRCm39) missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65,292,556 (GRCm39) missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65,304,983 (GRCm39) missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65,286,118 (GRCm39) missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65,310,470 (GRCm39) missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65,263,360 (GRCm39) missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65,302,136 (GRCm39) critical splice donor site probably null
R1501:Pikfyve UTSW 1 65,304,443 (GRCm39) missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65,291,707 (GRCm39) missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65,285,529 (GRCm39) missense probably benign
R1773:Pikfyve UTSW 1 65,231,430 (GRCm39) missense probably damaging 0.99
R1795:Pikfyve UTSW 1 65,291,716 (GRCm39) missense probably damaging 1.00
R1855:Pikfyve UTSW 1 65,297,957 (GRCm39) missense probably benign 0.03
R1905:Pikfyve UTSW 1 65,231,454 (GRCm39) critical splice donor site probably null
R1995:Pikfyve UTSW 1 65,285,867 (GRCm39) missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65,261,516 (GRCm39) missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65,292,512 (GRCm39) missense probably benign 0.06
R2229:Pikfyve UTSW 1 65,307,014 (GRCm39) missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65,285,835 (GRCm39) missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65,292,676 (GRCm39) missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65,284,917 (GRCm39) missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65,283,579 (GRCm39) missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65,270,004 (GRCm39) missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65,235,840 (GRCm39) missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65,229,679 (GRCm39) unclassified probably benign
R4542:Pikfyve UTSW 1 65,283,589 (GRCm39) missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65,231,351 (GRCm39) missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65,273,421 (GRCm39) missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4716:Pikfyve UTSW 1 65,285,635 (GRCm39) missense possibly damaging 0.84
R4758:Pikfyve UTSW 1 65,311,674 (GRCm39) missense possibly damaging 0.84
R4784:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4785:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4805:Pikfyve UTSW 1 65,307,959 (GRCm39) missense probably damaging 0.99
R4837:Pikfyve UTSW 1 65,285,749 (GRCm39) missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65,263,276 (GRCm39) intron probably benign
R5265:Pikfyve UTSW 1 65,306,988 (GRCm39) missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65,235,858 (GRCm39) nonsense probably null
R5384:Pikfyve UTSW 1 65,283,568 (GRCm39) missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65,304,427 (GRCm39) missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65,274,192 (GRCm39) missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65,291,654 (GRCm39) missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65,312,889 (GRCm39) missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65,295,247 (GRCm39) missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65,255,187 (GRCm39) missense probably benign 0.09
R5891:Pikfyve UTSW 1 65,241,896 (GRCm39) missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65,292,597 (GRCm39) nonsense probably null
R6026:Pikfyve UTSW 1 65,311,856 (GRCm39) missense probably damaging 1.00
R6057:Pikfyve UTSW 1 65,311,730 (GRCm39) missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65,255,202 (GRCm39) missense probably benign 0.36
R6287:Pikfyve UTSW 1 65,292,691 (GRCm39) critical splice donor site probably null
R6290:Pikfyve UTSW 1 65,242,084 (GRCm39) critical splice donor site probably null
R6296:Pikfyve UTSW 1 65,302,112 (GRCm39) missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65,304,940 (GRCm39) missense probably benign 0.35
R6835:Pikfyve UTSW 1 65,298,002 (GRCm39) missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65,291,689 (GRCm39) missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65,285,822 (GRCm39) missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65,273,520 (GRCm39) missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65,286,013 (GRCm39) missense probably benign 0.01
R7057:Pikfyve UTSW 1 65,286,364 (GRCm39) missense probably benign 0.00
R7525:Pikfyve UTSW 1 65,283,585 (GRCm39) nonsense probably null
R7558:Pikfyve UTSW 1 65,311,782 (GRCm39) missense probably benign 0.01
R7625:Pikfyve UTSW 1 65,307,036 (GRCm39) missense possibly damaging 0.86
R7807:Pikfyve UTSW 1 65,309,101 (GRCm39) missense probably damaging 1.00
R7961:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8154:Pikfyve UTSW 1 65,304,948 (GRCm39) missense probably damaging 1.00
R8192:Pikfyve UTSW 1 65,285,554 (GRCm39) missense possibly damaging 0.93
R8275:Pikfyve UTSW 1 65,292,501 (GRCm39) splice site probably benign
R8307:Pikfyve UTSW 1 65,284,894 (GRCm39) missense possibly damaging 0.77
R8710:Pikfyve UTSW 1 65,255,155 (GRCm39) missense possibly damaging 0.94
R8867:Pikfyve UTSW 1 65,283,576 (GRCm39) missense probably damaging 1.00
R8936:Pikfyve UTSW 1 65,310,427 (GRCm39) missense possibly damaging 0.84
R8940:Pikfyve UTSW 1 65,286,129 (GRCm39) missense probably benign 0.00
R8995:Pikfyve UTSW 1 65,244,746 (GRCm39) critical splice acceptor site probably null
R9092:Pikfyve UTSW 1 65,283,559 (GRCm39) missense probably damaging 1.00
R9131:Pikfyve UTSW 1 65,285,239 (GRCm39) missense probably damaging 1.00
R9151:Pikfyve UTSW 1 65,235,898 (GRCm39) missense probably damaging 1.00
R9210:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9212:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9235:Pikfyve UTSW 1 65,299,188 (GRCm39) missense probably benign 0.37
R9368:Pikfyve UTSW 1 65,307,901 (GRCm39) missense probably damaging 1.00
R9489:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9605:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9686:Pikfyve UTSW 1 65,291,615 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTAAGAAGCCCTCACAGCAC -3'
(R):5'- GTCCATAAACTCTCTCCATTACCAG -3'

Sequencing Primer
(F):5'- AGCCCTCACAGCACACATTTTTG -3'
(R):5'- AGTCAAGTCAACCTTTACTTTGTG -3'
Posted On 2016-03-01