Incidental Mutation 'R4831:Slamf9'
ID 372782
Institutional Source Beutler Lab
Gene Symbol Slamf9
Ensembl Gene ENSMUSG00000026548
Gene Name SLAM family member 9
Synonyms CD2F-10, Cd2f10, CD84-H1, SF2001, 2310026I04Rik
MMRRC Submission 042447-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4831 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 172302927-172305976 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 172304831 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 148 (C148*)
Ref Sequence ENSEMBL: ENSMUSP00000027830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027830] [ENSMUST00000052629] [ENSMUST00000127052] [ENSMUST00000127482] [ENSMUST00000135267]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000027830
AA Change: C148*
SMART Domains Protein: ENSMUSP00000027830
Gene: ENSMUSG00000026548
AA Change: C148*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 25 128 2.68e-4 SMART
Blast:IG_like 139 198 7e-8 BLAST
low complexity region 199 216 N/A INTRINSIC
transmembrane domain 231 253 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052629
SMART Domains Protein: ENSMUSP00000058275
Gene: ENSMUSG00000037995

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
FN3 508 593 1.82e-4 SMART
FN3 624 705 7.01e-6 SMART
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
low complexity region 909 930 N/A INTRINSIC
low complexity region 942 953 N/A INTRINSIC
low complexity region 1143 1165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127052
SMART Domains Protein: ENSMUSP00000123401
Gene: ENSMUSG00000037995

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Blast:IG 26 109 6e-55 BLAST
SCOP:d1biha2 28 108 6e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127482
SMART Domains Protein: ENSMUSP00000117854
Gene: ENSMUSG00000037995

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192784
Predicted Effect probably benign
Transcript: ENSMUST00000135267
SMART Domains Protein: ENSMUSP00000116948
Gene: ENSMUSG00000037995

DomainStartEndE-ValueType
IG_like 4 68 3.29e1 SMART
IGc2 86 148 3.03e-12 SMART
low complexity region 156 168 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (96/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signaling lymphocytic activation molecule family. The encoded protein is a cell surface molecule that consists of two extracellular immunoglobulin domains, a transmembrane domain and a short cytoplasmic tail that lacks the signal transduction motifs found in other family members. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik C T 11: 69,791,403 (GRCm39) V59I possibly damaging Het
4930544M13Rik T G 13: 114,744,183 (GRCm39) noncoding transcript Het
Abca13 A T 11: 9,492,077 (GRCm39) K4373* probably null Het
Abtb2 A T 2: 103,513,820 (GRCm39) T410S probably benign Het
Adamts13 T C 2: 26,873,142 (GRCm39) probably null Het
Ahnak2 C G 12: 112,742,183 (GRCm39) D630H probably damaging Het
Aox3 T C 1: 58,191,725 (GRCm39) S426P probably damaging Het
Atxn10 C T 15: 85,271,260 (GRCm39) S266F probably benign Het
B4galnt4 G T 7: 140,647,634 (GRCm39) M407I probably damaging Het
B4galnt4 T A 7: 140,644,470 (GRCm39) probably null Het
Bclaf1 T A 10: 20,197,872 (GRCm39) probably benign Het
C4b C T 17: 34,955,864 (GRCm39) probably null Het
Cdc42bpg T C 19: 6,361,365 (GRCm39) F297S probably damaging Het
Cdh10 A T 15: 19,013,664 (GRCm39) T755S probably benign Het
Ceacam12 T A 7: 17,811,305 (GRCm39) probably null Het
Cfap65 C A 1: 74,956,454 (GRCm39) V1042F possibly damaging Het
Cfap77 T C 2: 28,875,844 (GRCm39) I89V probably benign Het
Cfh T C 1: 140,014,125 (GRCm39) D688G probably benign Het
Clip1 C G 5: 123,721,664 (GRCm39) A1182P probably damaging Het
Cyp2b10 T A 7: 25,614,921 (GRCm39) Y309* probably null Het
Dcaf5 T C 12: 80,385,858 (GRCm39) E756G probably benign Het
Dctn1 A T 6: 83,176,753 (GRCm39) Q1231L possibly damaging Het
Dennd1c T A 17: 57,373,428 (GRCm39) R682* probably null Het
Eml6 C A 11: 29,727,052 (GRCm39) E1319* probably null Het
Erap1 T C 13: 74,838,766 (GRCm39) I904T probably damaging Het
Eri1 A T 8: 35,943,673 (GRCm39) I207N possibly damaging Het
Farp1 G A 14: 121,514,469 (GRCm39) A933T probably damaging Het
Fcna T A 2: 25,515,353 (GRCm39) Q210L probably benign Het
Fhad1 A T 4: 141,643,378 (GRCm39) probably null Het
Fut8 T G 12: 77,440,603 (GRCm39) Y197D probably damaging Het
Garem1 G A 18: 21,262,825 (GRCm39) T663I probably benign Het
Gfm2 T C 13: 97,301,546 (GRCm39) S450P probably damaging Het
Gstk1 T G 6: 42,222,938 (GRCm39) probably benign Het
Helz2 C T 2: 180,879,210 (GRCm39) A803T probably damaging Het
Igsf9 T A 1: 172,319,455 (GRCm39) I280N probably damaging Het
Klhl10 A G 11: 100,336,669 (GRCm39) K219E probably benign Het
L3mbtl4 T A 17: 68,768,558 (GRCm39) V222D probably damaging Het
Lrrc9 A T 12: 72,546,453 (GRCm39) N1214Y probably damaging Het
Ltbp2 C T 12: 84,840,414 (GRCm39) E1051K possibly damaging Het
Mettl17 T C 14: 52,122,440 (GRCm39) F13S probably benign Het
Mettl24 C A 10: 40,559,413 (GRCm39) A21D possibly damaging Het
Mfsd6l T A 11: 68,447,331 (GRCm39) C61S probably benign Het
Mob4 T G 1: 55,191,899 (GRCm39) D204E probably benign Het
Mtus1 C G 8: 41,536,189 (GRCm39) R509T probably damaging Het
Nlrp4a T A 7: 26,149,844 (GRCm39) F484I possibly damaging Het
Nsrp1 T C 11: 76,941,444 (GRCm39) N88S probably benign Het
Odad2 G T 18: 7,222,564 (GRCm39) H568Q possibly damaging Het
Or10d5 C T 9: 39,861,408 (GRCm39) V220I probably benign Het
Or2g25 T A 17: 37,970,969 (GRCm39) H85L probably benign Het
Or51b6b T C 7: 103,309,678 (GRCm39) T260A probably benign Het
Or6c2 T A 10: 129,362,449 (GRCm39) Y118N probably damaging Het
Parg A G 14: 31,924,408 (GRCm39) N69S probably benign Het
Pcdh9 A C 14: 94,125,377 (GRCm39) N264K probably damaging Het
Pcdhb22 G T 18: 37,653,615 (GRCm39) L694F probably damaging Het
Pcnt T C 10: 76,248,335 (GRCm39) E928G probably damaging Het
Pdzk1 G A 3: 96,775,751 (GRCm39) G373D probably benign Het
Pea15a A G 1: 172,026,740 (GRCm39) I89T probably damaging Het
Phc1 T A 6: 122,313,964 (GRCm39) probably benign Het
Pikfyve T A 1: 65,235,900 (GRCm39) C191S probably damaging Het
Pitpnm1 T A 19: 4,158,130 (GRCm39) D573E probably damaging Het
Pld5 A G 1: 176,102,450 (GRCm39) probably benign Het
Plscr2 A T 9: 92,173,130 (GRCm39) N89I possibly damaging Het
Pm20d2 A C 4: 33,179,293 (GRCm39) N315K probably damaging Het
Pnpla1 T A 17: 29,097,518 (GRCm39) M228K probably benign Het
Prim2 T C 1: 33,709,217 (GRCm39) probably benign Het
Ralgapa2 A G 2: 146,246,987 (GRCm39) probably benign Het
Rgs22 G T 15: 36,050,294 (GRCm39) H719N probably benign Het
Ror2 C T 13: 53,272,880 (GRCm39) D250N probably damaging Het
Saal1 A G 7: 46,349,071 (GRCm39) V281A probably benign Het
Selenof A T 3: 144,296,411 (GRCm39) K94N probably damaging Het
Slc4a7 T C 14: 14,772,699 (GRCm38) probably null Het
Slco1a5 A G 6: 142,180,431 (GRCm39) I657T probably benign Het
St3gal2 A T 8: 111,684,480 (GRCm39) H46L probably benign Het
Sucnr1 T G 3: 59,994,069 (GRCm39) M199R probably damaging Het
Taok1 T A 11: 77,444,500 (GRCm39) E525V probably null Het
Tbc1d10c T A 19: 4,235,445 (GRCm39) E298V probably damaging Het
Tll2 T A 19: 41,118,951 (GRCm39) H259L probably damaging Het
Tpcn1 A T 5: 120,691,554 (GRCm39) F300Y probably damaging Het
Uba6 T A 5: 86,279,197 (GRCm39) I642L probably benign Het
Ubqln5 T A 7: 103,778,829 (GRCm39) probably benign Het
Vmn1r27 A T 6: 58,192,827 (GRCm39) L9Q possibly damaging Het
Vmn2r100 C T 17: 19,741,672 (GRCm39) T128I probably benign Het
Vmn2r109 C T 17: 20,761,494 (GRCm39) G621D probably benign Het
Vmn2r49 C T 7: 9,720,352 (GRCm39) D380N probably benign Het
Vps13a C T 19: 16,655,356 (GRCm39) V1891I probably benign Het
Wbp2 G T 11: 115,971,463 (GRCm39) Y147* probably null Het
Wdr46 T A 17: 34,160,810 (GRCm39) N191K probably benign Het
Wdr46 T C 17: 34,168,373 (GRCm39) probably benign Het
Wnt2 A C 6: 18,023,285 (GRCm39) F121L probably benign Het
Xpnpep1 T A 19: 53,003,053 (GRCm39) D100V probably benign Het
Xpo4 T C 14: 57,827,559 (GRCm39) Y879C probably damaging Het
Zswim4 A T 8: 84,938,948 (GRCm39) V978D probably damaging Het
Other mutations in Slamf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0020:Slamf9 UTSW 1 172,303,082 (GRCm39) missense possibly damaging 0.84
R1220:Slamf9 UTSW 1 172,304,898 (GRCm39) missense probably benign 0.20
R1646:Slamf9 UTSW 1 172,304,907 (GRCm39) missense probably benign 0.00
R2321:Slamf9 UTSW 1 172,304,980 (GRCm39) missense probably damaging 1.00
R4124:Slamf9 UTSW 1 172,303,808 (GRCm39) missense probably damaging 1.00
R4826:Slamf9 UTSW 1 172,304,008 (GRCm39) missense probably benign 0.01
R5010:Slamf9 UTSW 1 172,303,780 (GRCm39) missense possibly damaging 0.80
R5223:Slamf9 UTSW 1 172,303,799 (GRCm39) missense possibly damaging 0.89
R5864:Slamf9 UTSW 1 172,304,033 (GRCm39) missense probably benign 0.25
R7480:Slamf9 UTSW 1 172,305,040 (GRCm39) missense probably damaging 1.00
R8145:Slamf9 UTSW 1 172,303,942 (GRCm39) missense probably benign 0.37
R9045:Slamf9 UTSW 1 172,304,938 (GRCm39) missense probably damaging 0.96
R9747:Slamf9 UTSW 1 172,305,782 (GRCm39) missense unknown
X0054:Slamf9 UTSW 1 172,305,668 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGACCCTGCAACCACAATTTATG -3'
(R):5'- TGCGACGGGAACTGATGTTG -3'

Sequencing Primer
(F):5'- GACCCAACTCTGGAATGT -3'
(R):5'- AACTGATGTTGCTGATGGGG -3'
Posted On 2016-03-01