Incidental Mutation 'R4831:Tpcn1'
ID372798
Institutional Source Beutler Lab
Gene Symbol Tpcn1
Ensembl Gene ENSMUSG00000032741
Gene Nametwo pore channel 1
Synonyms5730403B01Rik
MMRRC Submission 042447-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4831 (G1)
Quality Score83
Status Validated
Chromosome5
Chromosomal Location120534153-120588673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120553489 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 300 (F300Y)
Ref Sequence ENSEMBL: ENSMUSP00000042188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046426]
Predicted Effect probably damaging
Transcript: ENSMUST00000046426
AA Change: F300Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042188
Gene: ENSMUSG00000032741
AA Change: F300Y

DomainStartEndE-ValueType
Pfam:Ion_trans 106 332 1.5e-30 PFAM
Pfam:Ion_trans 441 695 1.2e-31 PFAM
SCOP:d1fxkc_ 713 795 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201971
Meta Mutation Damage Score 0.1453 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (96/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated Ca(2+) and Na+ channels have 4 homologous domains, each containing 6 transmembrane segments, S1 to S6. TPCN1 is similar to these channels, but it has only 2 domains containing S1 to S6 (Ishibashi et al., 2000 [PubMed 10753632]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene results in no apparent phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik C T 11: 69,900,577 V59I possibly damaging Het
4930544M13Rik T G 13: 114,607,647 noncoding transcript Het
Abca13 A T 11: 9,542,077 K4373* probably null Het
Abtb2 A T 2: 103,683,475 T410S probably benign Het
Adamts13 T C 2: 26,983,130 probably null Het
Ahnak2 C G 12: 112,775,749 D630H probably damaging Het
Aox3 T C 1: 58,152,566 S426P probably damaging Het
Armc4 G T 18: 7,222,564 H568Q possibly damaging Het
Atxn10 C T 15: 85,387,059 S266F probably benign Het
B4galnt4 T A 7: 141,064,557 probably null Het
B4galnt4 G T 7: 141,067,721 M407I probably damaging Het
Bclaf1 T A 10: 20,322,126 probably benign Het
C4b C T 17: 34,736,890 probably null Het
Cdc42bpg T C 19: 6,311,335 F297S probably damaging Het
Cdh10 A T 15: 19,013,578 T755S probably benign Het
Ceacam12 T A 7: 18,077,380 probably null Het
Cfap65 C A 1: 74,917,295 V1042F possibly damaging Het
Cfap77 T C 2: 28,985,832 I89V probably benign Het
Cfh T C 1: 140,086,387 D688G probably benign Het
Clip1 C G 5: 123,583,601 A1182P probably damaging Het
Cyp2b10 T A 7: 25,915,496 Y309* probably null Het
Dcaf5 T C 12: 80,339,084 E756G probably benign Het
Dctn1 A T 6: 83,199,771 Q1231L possibly damaging Het
Dennd1c T A 17: 57,066,428 R682* probably null Het
Eml6 C A 11: 29,777,052 E1319* probably null Het
Erap1 T C 13: 74,690,647 I904T probably damaging Het
Eri1 A T 8: 35,476,519 I207N possibly damaging Het
Farp1 G A 14: 121,277,057 A933T probably damaging Het
Fcna T A 2: 25,625,341 Q210L probably benign Het
Fhad1 A T 4: 141,916,067 probably null Het
Fut8 T G 12: 77,393,829 Y197D probably damaging Het
Garem1 G A 18: 21,129,768 T663I probably benign Het
Gfm2 T C 13: 97,165,038 S450P probably damaging Het
Gstk1 T G 6: 42,246,004 probably benign Het
Helz2 C T 2: 181,237,417 A803T probably damaging Het
Igsf9 T A 1: 172,491,888 I280N probably damaging Het
Klhl10 A G 11: 100,445,843 K219E probably benign Het
L3mbtl4 T A 17: 68,461,563 V222D probably damaging Het
Lrrc9 A T 12: 72,499,679 N1214Y probably damaging Het
Ltbp2 C T 12: 84,793,640 E1051K possibly damaging Het
Mettl17 T C 14: 51,884,983 F13S probably benign Het
Mettl24 C A 10: 40,683,417 A21D possibly damaging Het
Mfsd6l T A 11: 68,556,505 C61S probably benign Het
Mob4 T G 1: 55,152,740 D204E probably benign Het
Mtus1 C G 8: 41,083,152 R509T probably damaging Het
Nlrp4a T A 7: 26,450,419 F484I possibly damaging Het
Nsrp1 T C 11: 77,050,618 N88S probably benign Het
Olfr117 T A 17: 37,660,078 H85L probably benign Het
Olfr623 T C 7: 103,660,471 T260A probably benign Het
Olfr791 T A 10: 129,526,580 Y118N probably damaging Het
Olfr975 C T 9: 39,950,112 V220I probably benign Het
Parg A G 14: 32,202,451 N69S probably benign Het
Pcdh9 A C 14: 93,887,941 N264K probably damaging Het
Pcdhb22 G T 18: 37,520,562 L694F probably damaging Het
Pcnt T C 10: 76,412,501 E928G probably damaging Het
Pdzk1 G A 3: 96,868,435 G373D probably benign Het
Pea15a A G 1: 172,199,173 I89T probably damaging Het
Phc1 T A 6: 122,337,005 probably benign Het
Pikfyve T A 1: 65,196,741 C191S probably damaging Het
Pitpnm1 T A 19: 4,108,130 D573E probably damaging Het
Pld5 A G 1: 176,274,884 probably benign Het
Plscr2 A T 9: 92,291,077 N89I possibly damaging Het
Pm20d2 A C 4: 33,179,293 N315K probably damaging Het
Pnpla1 T A 17: 28,878,544 M228K probably benign Het
Prim2 T C 1: 33,670,136 probably benign Het
Ralgapa2 A G 2: 146,405,067 probably benign Het
Rgs22 G T 15: 36,050,148 H719N probably benign Het
Ror2 C T 13: 53,118,844 D250N probably damaging Het
Saal1 A G 7: 46,699,647 V281A probably benign Het
Selenof A T 3: 144,590,650 K94N probably damaging Het
Slamf9 T A 1: 172,477,264 C148* probably null Het
Slc4a7 T C 14: 14,772,699 probably null Het
Slco1a5 A G 6: 142,234,705 I657T probably benign Het
St3gal2 A T 8: 110,957,848 H46L probably benign Het
Sucnr1 T G 3: 60,086,648 M199R probably damaging Het
Taok1 T A 11: 77,553,674 E525V probably null Het
Tbc1d10c T A 19: 4,185,446 E298V probably damaging Het
Tll2 T A 19: 41,130,512 H259L probably damaging Het
Uba6 T A 5: 86,131,338 I642L probably benign Het
Ubqln5 T A 7: 104,129,622 probably benign Het
Vmn1r27 A T 6: 58,215,842 L9Q possibly damaging Het
Vmn2r100 C T 17: 19,521,410 T128I probably benign Het
Vmn2r109 C T 17: 20,541,232 G621D probably benign Het
Vmn2r49 C T 7: 9,986,425 D380N probably benign Het
Vps13a C T 19: 16,677,992 V1891I probably benign Het
Wbp2 G T 11: 116,080,637 Y147* probably null Het
Wdr46 T A 17: 33,941,836 N191K probably benign Het
Wdr46 T C 17: 33,949,399 probably benign Het
Wnt2 A C 6: 18,023,286 F121L probably benign Het
Xpnpep1 T A 19: 53,014,622 D100V probably benign Het
Xpo4 T C 14: 57,590,102 Y879C probably damaging Het
Zswim4 A T 8: 84,212,319 V978D probably damaging Het
Other mutations in Tpcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Tpcn1 APN 5 120545305 missense probably damaging 0.99
IGL00551:Tpcn1 APN 5 120560325 missense probably benign 0.31
IGL02197:Tpcn1 APN 5 120553531 missense probably damaging 1.00
IGL02584:Tpcn1 APN 5 120539032 missense probably damaging 0.99
IGL03064:Tpcn1 APN 5 120537566 missense possibly damaging 0.90
PIT1430001:Tpcn1 UTSW 5 120548323 splice site probably benign
R0295:Tpcn1 UTSW 5 120539060 missense probably damaging 1.00
R0316:Tpcn1 UTSW 5 120539259 missense probably damaging 1.00
R1577:Tpcn1 UTSW 5 120544420 missense probably damaging 1.00
R1660:Tpcn1 UTSW 5 120549515 missense possibly damaging 0.82
R1819:Tpcn1 UTSW 5 120536227 splice site probably null
R2051:Tpcn1 UTSW 5 120543388 missense probably damaging 1.00
R2364:Tpcn1 UTSW 5 120553494 nonsense probably null
R2497:Tpcn1 UTSW 5 120538998 splice site probably null
R3965:Tpcn1 UTSW 5 120556575 missense probably damaging 0.98
R3972:Tpcn1 UTSW 5 120553752 critical splice donor site probably null
R4062:Tpcn1 UTSW 5 120557897 missense possibly damaging 0.82
R4343:Tpcn1 UTSW 5 120560220 missense probably damaging 1.00
R4422:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4423:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4424:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4655:Tpcn1 UTSW 5 120539257 missense probably damaging 0.98
R4910:Tpcn1 UTSW 5 120556519 missense probably damaging 0.98
R4948:Tpcn1 UTSW 5 120556531 missense probably benign 0.15
R4965:Tpcn1 UTSW 5 120547487 missense possibly damaging 0.82
R4976:Tpcn1 UTSW 5 120560322 missense probably benign
R5071:Tpcn1 UTSW 5 120548269 critical splice donor site probably null
R5165:Tpcn1 UTSW 5 120557945 missense probably damaging 1.00
R5210:Tpcn1 UTSW 5 120539214 missense probably damaging 1.00
R5910:Tpcn1 UTSW 5 120547397 intron probably benign
R5939:Tpcn1 UTSW 5 120539827 missense probably damaging 1.00
R6364:Tpcn1 UTSW 5 120553810 missense probably damaging 1.00
R6633:Tpcn1 UTSW 5 120544464 missense probably benign 0.03
R6650:Tpcn1 UTSW 5 120537562 missense probably null 0.50
R6885:Tpcn1 UTSW 5 120544437 missense probably benign 0.21
R7038:Tpcn1 UTSW 5 120585277 missense probably damaging 0.99
R7247:Tpcn1 UTSW 5 120585250 missense possibly damaging 0.63
R7594:Tpcn1 UTSW 5 120556530 missense possibly damaging 0.67
R7629:Tpcn1 UTSW 5 120537937 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATTTTCACTGCAGGGGTGG -3'
(R):5'- TCTCAGTGAACACAGGGCTGAG -3'

Sequencing Primer
(F):5'- CGGCACCATCTACAAAGTGGAG -3'
(R):5'- TGAACACAGGGCTGAGTGGAG -3'
Posted On2016-03-01