Incidental Mutation 'R4831:Dctn1'
ID372803
Institutional Source Beutler Lab
Gene Symbol Dctn1
Ensembl Gene ENSMUSG00000031865
Gene Namedynactin 1
Synonymsp150, Glued, p150
MMRRC Submission 042447-MU
Accession Numbers

Ncbi RefSeq: NM_007835.2, NM_001198866.1, NM_001198867.1; MGI: 107745

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4831 (G1)
Quality Score158
Status Validated
Chromosome6
Chromosomal Location83165920-83200117 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83199771 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1231 (Q1231L)
Ref Sequence ENSEMBL: ENSMUSP00000109551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077407] [ENSMUST00000113907] [ENSMUST00000113913] [ENSMUST00000113918] [ENSMUST00000113919]
Predicted Effect probably benign
Transcript: ENSMUST00000077407
AA Change: Q1227L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076623
Gene: ENSMUSG00000031865
AA Change: Q1227L

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 124 147 N/A INTRINSIC
low complexity region 148 177 N/A INTRINSIC
SCOP:d1fxkc_ 185 337 3e-3 SMART
low complexity region 363 379 N/A INTRINSIC
Pfam:Dynactin 489 768 8.2e-91 PFAM
low complexity region 800 820 N/A INTRINSIC
coiled coil region 914 1009 N/A INTRINSIC
low complexity region 1025 1043 N/A INTRINSIC
coiled coil region 1143 1172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113907
AA Change: Q1130L

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109540
Gene: ENSMUSG00000031865
AA Change: Q1130L

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
low complexity region 27 50 N/A INTRINSIC
low complexity region 51 80 N/A INTRINSIC
low complexity region 93 106 N/A INTRINSIC
low complexity region 140 158 N/A INTRINSIC
SCOP:d1lxa__ 271 345 8e-3 SMART
Pfam:Dynactin 392 671 7.1e-91 PFAM
low complexity region 703 723 N/A INTRINSIC
coiled coil region 817 912 N/A INTRINSIC
low complexity region 928 946 N/A INTRINSIC
coiled coil region 1046 1075 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113913
AA Change: Q1252L
SMART Domains Protein: ENSMUSP00000109546
Gene: ENSMUSG00000031865
AA Change: Q1252L

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 118 139 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 168 197 N/A INTRINSIC
SCOP:d1fxkc_ 205 357 3e-3 SMART
low complexity region 383 399 N/A INTRINSIC
Pfam:Dynactin 509 788 2.5e-90 PFAM
low complexity region 820 840 N/A INTRINSIC
coiled coil region 934 1029 N/A INTRINSIC
low complexity region 1051 1069 N/A INTRINSIC
coiled coil region 1168 1197 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113918
AA Change: Q1231L

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109551
Gene: ENSMUSG00000031865
AA Change: Q1231L

DomainStartEndE-ValueType
CAP_GLY 29 95 5.52e-31 SMART
low complexity region 135 156 N/A INTRINSIC
low complexity region 161 184 N/A INTRINSIC
low complexity region 185 214 N/A INTRINSIC
low complexity region 227 240 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 400 416 N/A INTRINSIC
Pfam:Dynactin 526 805 3.3e-90 PFAM
low complexity region 837 857 N/A INTRINSIC
coiled coil region 951 1046 N/A INTRINSIC
coiled coil region 1147 1176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113919
AA Change: Q1269L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109552
Gene: ENSMUSG00000031865
AA Change: Q1269L

DomainStartEndE-ValueType
CAP_GLY 29 95 5.52e-31 SMART
low complexity region 135 156 N/A INTRINSIC
low complexity region 161 184 N/A INTRINSIC
low complexity region 185 214 N/A INTRINSIC
SCOP:d1fxkc_ 222 374 3e-3 SMART
low complexity region 400 416 N/A INTRINSIC
Pfam:Dynactin 522 805 1.4e-103 PFAM
low complexity region 837 857 N/A INTRINSIC
coiled coil region 951 1046 N/A INTRINSIC
low complexity region 1068 1086 N/A INTRINSIC
coiled coil region 1185 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154420
Meta Mutation Damage Score 0.0733 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (96/97)
MGI Phenotype Strain: 3769512
Lethality: E8-E10
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. Dynactin is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit interacts with dynein intermediate chain by its domains directly binding to dynein and binds to microtubules via a highly conserved glycine-rich cytoskeleton-associated protein (CAP-Gly) domain in its N-terminus. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause distal hereditary motor neuronopathy type VIIB (HMN7B) which is also known as distal spinal and bulbar muscular atrophy (dSBMA). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality and developmental arrest at E7.5 associated with increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Targeted(4) Gene trapped(16)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik C T 11: 69,900,577 V59I possibly damaging Het
4930544M13Rik T G 13: 114,607,647 noncoding transcript Het
Abca13 A T 11: 9,542,077 K4373* probably null Het
Abtb2 A T 2: 103,683,475 T410S probably benign Het
Adamts13 T C 2: 26,983,130 probably null Het
Ahnak2 C G 12: 112,775,749 D630H probably damaging Het
Aox3 T C 1: 58,152,566 S426P probably damaging Het
Armc4 G T 18: 7,222,564 H568Q possibly damaging Het
Atxn10 C T 15: 85,387,059 S266F probably benign Het
B4galnt4 G T 7: 141,067,721 M407I probably damaging Het
B4galnt4 T A 7: 141,064,557 probably null Het
Bclaf1 T A 10: 20,322,126 probably benign Het
C4b C T 17: 34,736,890 probably null Het
Cdc42bpg T C 19: 6,311,335 F297S probably damaging Het
Cdh10 A T 15: 19,013,578 T755S probably benign Het
Ceacam12 T A 7: 18,077,380 probably null Het
Cfap65 C A 1: 74,917,295 V1042F possibly damaging Het
Cfap77 T C 2: 28,985,832 I89V probably benign Het
Cfh T C 1: 140,086,387 D688G probably benign Het
Clip1 C G 5: 123,583,601 A1182P probably damaging Het
Cyp2b10 T A 7: 25,915,496 Y309* probably null Het
Dcaf5 T C 12: 80,339,084 E756G probably benign Het
Dennd1c T A 17: 57,066,428 R682* probably null Het
Eml6 C A 11: 29,777,052 E1319* probably null Het
Erap1 T C 13: 74,690,647 I904T probably damaging Het
Eri1 A T 8: 35,476,519 I207N possibly damaging Het
Farp1 G A 14: 121,277,057 A933T probably damaging Het
Fcna T A 2: 25,625,341 Q210L probably benign Het
Fhad1 A T 4: 141,916,067 probably null Het
Fut8 T G 12: 77,393,829 Y197D probably damaging Het
Garem1 G A 18: 21,129,768 T663I probably benign Het
Gfm2 T C 13: 97,165,038 S450P probably damaging Het
Gstk1 T G 6: 42,246,004 probably benign Het
Helz2 C T 2: 181,237,417 A803T probably damaging Het
Igsf9 T A 1: 172,491,888 I280N probably damaging Het
Klhl10 A G 11: 100,445,843 K219E probably benign Het
L3mbtl4 T A 17: 68,461,563 V222D probably damaging Het
Lrrc9 A T 12: 72,499,679 N1214Y probably damaging Het
Ltbp2 C T 12: 84,793,640 E1051K possibly damaging Het
Mettl17 T C 14: 51,884,983 F13S probably benign Het
Mettl24 C A 10: 40,683,417 A21D possibly damaging Het
Mfsd6l T A 11: 68,556,505 C61S probably benign Het
Mob4 T G 1: 55,152,740 D204E probably benign Het
Mtus1 C G 8: 41,083,152 R509T probably damaging Het
Nlrp4a T A 7: 26,450,419 F484I possibly damaging Het
Nsrp1 T C 11: 77,050,618 N88S probably benign Het
Olfr117 T A 17: 37,660,078 H85L probably benign Het
Olfr623 T C 7: 103,660,471 T260A probably benign Het
Olfr791 T A 10: 129,526,580 Y118N probably damaging Het
Olfr975 C T 9: 39,950,112 V220I probably benign Het
Parg A G 14: 32,202,451 N69S probably benign Het
Pcdh9 A C 14: 93,887,941 N264K probably damaging Het
Pcdhb22 G T 18: 37,520,562 L694F probably damaging Het
Pcnt T C 10: 76,412,501 E928G probably damaging Het
Pdzk1 G A 3: 96,868,435 G373D probably benign Het
Pea15a A G 1: 172,199,173 I89T probably damaging Het
Phc1 T A 6: 122,337,005 probably benign Het
Pikfyve T A 1: 65,196,741 C191S probably damaging Het
Pitpnm1 T A 19: 4,108,130 D573E probably damaging Het
Pld5 A G 1: 176,274,884 probably benign Het
Plscr2 A T 9: 92,291,077 N89I possibly damaging Het
Pm20d2 A C 4: 33,179,293 N315K probably damaging Het
Pnpla1 T A 17: 28,878,544 M228K probably benign Het
Prim2 T C 1: 33,670,136 probably benign Het
Ralgapa2 A G 2: 146,405,067 probably benign Het
Rgs22 G T 15: 36,050,148 H719N probably benign Het
Ror2 C T 13: 53,118,844 D250N probably damaging Het
Saal1 A G 7: 46,699,647 V281A probably benign Het
Selenof A T 3: 144,590,650 K94N probably damaging Het
Slamf9 T A 1: 172,477,264 C148* probably null Het
Slc4a7 T C 14: 14,772,699 probably null Het
Slco1a5 A G 6: 142,234,705 I657T probably benign Het
St3gal2 A T 8: 110,957,848 H46L probably benign Het
Sucnr1 T G 3: 60,086,648 M199R probably damaging Het
Taok1 T A 11: 77,553,674 E525V probably null Het
Tbc1d10c T A 19: 4,185,446 E298V probably damaging Het
Tll2 T A 19: 41,130,512 H259L probably damaging Het
Tpcn1 A T 5: 120,553,489 F300Y probably damaging Het
Uba6 T A 5: 86,131,338 I642L probably benign Het
Ubqln5 T A 7: 104,129,622 probably benign Het
Vmn1r27 A T 6: 58,215,842 L9Q possibly damaging Het
Vmn2r100 C T 17: 19,521,410 T128I probably benign Het
Vmn2r109 C T 17: 20,541,232 G621D probably benign Het
Vmn2r49 C T 7: 9,986,425 D380N probably benign Het
Vps13a C T 19: 16,677,992 V1891I probably benign Het
Wbp2 G T 11: 116,080,637 Y147* probably null Het
Wdr46 T A 17: 33,941,836 N191K probably benign Het
Wdr46 T C 17: 33,949,399 probably benign Het
Wnt2 A C 6: 18,023,286 F121L probably benign Het
Xpnpep1 T A 19: 53,014,622 D100V probably benign Het
Xpo4 T C 14: 57,590,102 Y879C probably damaging Het
Zswim4 A T 8: 84,212,319 V978D probably damaging Het
Other mutations in Dctn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Dctn1 APN 6 83179897 missense probably benign 0.00
IGL01450:Dctn1 APN 6 83194110 unclassified probably benign
IGL01876:Dctn1 APN 6 83197921 missense probably damaging 1.00
IGL01958:Dctn1 APN 6 83191344 missense possibly damaging 0.95
IGL02554:Dctn1 APN 6 83182722 missense probably damaging 1.00
IGL02668:Dctn1 APN 6 83191048 missense possibly damaging 0.89
IGL02814:Dctn1 APN 6 83189914 missense probably damaging 1.00
IGL02818:Dctn1 APN 6 83192514 missense possibly damaging 0.86
IGL03007:Dctn1 APN 6 83182708 missense probably damaging 1.00
IGL03065:Dctn1 APN 6 83192493 missense probably damaging 0.99
IGL03083:Dctn1 APN 6 83197484 splice site probably benign
IGL03394:Dctn1 APN 6 83191284 missense possibly damaging 0.61
E0374:Dctn1 UTSW 6 83194174 missense possibly damaging 0.93
IGL03014:Dctn1 UTSW 6 83197369 intron probably benign
PIT4812001:Dctn1 UTSW 6 83199762 missense possibly damaging 0.86
R0044:Dctn1 UTSW 6 83191134 missense probably damaging 1.00
R0047:Dctn1 UTSW 6 83182632 nonsense probably null
R0047:Dctn1 UTSW 6 83182632 nonsense probably null
R0057:Dctn1 UTSW 6 83179892 missense probably benign 0.14
R0731:Dctn1 UTSW 6 83183089 missense probably damaging 0.98
R0738:Dctn1 UTSW 6 83190107 critical splice donor site probably null
R0755:Dctn1 UTSW 6 83189077 missense probably damaging 0.96
R0839:Dctn1 UTSW 6 83190477 missense possibly damaging 0.53
R1035:Dctn1 UTSW 6 83190220 missense probably damaging 1.00
R1454:Dctn1 UTSW 6 83197508 missense possibly damaging 0.93
R1469:Dctn1 UTSW 6 83192889 missense probably damaging 1.00
R1469:Dctn1 UTSW 6 83192889 missense probably damaging 1.00
R1627:Dctn1 UTSW 6 83195082 missense probably damaging 0.99
R1631:Dctn1 UTSW 6 83197596 missense possibly damaging 0.56
R1812:Dctn1 UTSW 6 83192518 missense possibly damaging 0.85
R1928:Dctn1 UTSW 6 83199184 splice site probably benign
R2008:Dctn1 UTSW 6 83189956 missense probably damaging 0.99
R2242:Dctn1 UTSW 6 83199705 missense probably damaging 0.99
R2259:Dctn1 UTSW 6 83197586 missense possibly damaging 0.46
R2422:Dctn1 UTSW 6 83199800 missense possibly damaging 0.92
R2483:Dctn1 UTSW 6 83194187 missense probably damaging 1.00
R4455:Dctn1 UTSW 6 83195049 missense probably damaging 1.00
R4724:Dctn1 UTSW 6 83189938 missense possibly damaging 0.53
R4812:Dctn1 UTSW 6 83189937 missense probably benign 0.24
R4819:Dctn1 UTSW 6 83190519 missense probably damaging 0.97
R4928:Dctn1 UTSW 6 83189207 missense possibly damaging 0.73
R5087:Dctn1 UTSW 6 83191639 missense probably damaging 1.00
R5354:Dctn1 UTSW 6 83183126 missense possibly damaging 0.93
R5372:Dctn1 UTSW 6 83190210 missense probably damaging 0.96
R5493:Dctn1 UTSW 6 83182564 missense possibly damaging 0.89
R5494:Dctn1 UTSW 6 83182564 missense possibly damaging 0.89
R5732:Dctn1 UTSW 6 83197949 critical splice donor site probably null
R5856:Dctn1 UTSW 6 83197865 missense probably damaging 1.00
R6025:Dctn1 UTSW 6 83193691 intron probably null
R6999:Dctn1 UTSW 6 83191281 missense possibly damaging 0.89
R7052:Dctn1 UTSW 6 83195280 intron probably null
R7133:Dctn1 UTSW 6 83180044 intron probably null
R7485:Dctn1 UTSW 6 83189905 missense possibly damaging 0.85
R7607:Dctn1 UTSW 6 83195069 nonsense probably null
R7729:Dctn1 UTSW 6 83183060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTTACCGTGGTGTCAGAC -3'
(R):5'- AACCCAGGTTACGGAAGCAG -3'

Sequencing Primer
(F):5'- AGACGTGAAGCCTCAGTTTC -3'
(R):5'- TTACGGAAGCAGCAGGACCC -3'
Posted On2016-03-01