Incidental Mutation 'R4831:Nlrp4a'
ID372808
Institutional Source Beutler Lab
Gene Symbol Nlrp4a
Ensembl Gene ENSMUSG00000040601
Gene NameNLR family, pyrin domain containing 4A
SynonymsE330028A19Rik, Nalp-eta, Nalp4a
MMRRC Submission 042447-MU
Accession Numbers

Genbank: NM_172896; MGI: 2443697

Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4831 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location26435113-26476142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26450419 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 484 (F484I)
Ref Sequence ENSEMBL: ENSMUSP00000146044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068767] [ENSMUST00000119386] [ENSMUST00000146907]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068767
AA Change: F484I

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066841
Gene: ENSMUSG00000040601
AA Change: F484I

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 4.9e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119386
AA Change: F484I

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112441
Gene: ENSMUSG00000040601
AA Change: F484I

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 1.3e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146534
Predicted Effect possibly damaging
Transcript: ENSMUST00000146907
AA Change: F484I

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.0576 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (96/97)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik C T 11: 69,900,577 V59I possibly damaging Het
4930544M13Rik T G 13: 114,607,647 noncoding transcript Het
Abca13 A T 11: 9,542,077 K4373* probably null Het
Abtb2 A T 2: 103,683,475 T410S probably benign Het
Adamts13 T C 2: 26,983,130 probably null Het
Ahnak2 C G 12: 112,775,749 D630H probably damaging Het
Aox3 T C 1: 58,152,566 S426P probably damaging Het
Armc4 G T 18: 7,222,564 H568Q possibly damaging Het
Atxn10 C T 15: 85,387,059 S266F probably benign Het
B4galnt4 T A 7: 141,064,557 probably null Het
B4galnt4 G T 7: 141,067,721 M407I probably damaging Het
Bclaf1 T A 10: 20,322,126 probably benign Het
C4b C T 17: 34,736,890 probably null Het
Cdc42bpg T C 19: 6,311,335 F297S probably damaging Het
Cdh10 A T 15: 19,013,578 T755S probably benign Het
Ceacam12 T A 7: 18,077,380 probably null Het
Cfap65 C A 1: 74,917,295 V1042F possibly damaging Het
Cfap77 T C 2: 28,985,832 I89V probably benign Het
Cfh T C 1: 140,086,387 D688G probably benign Het
Clip1 C G 5: 123,583,601 A1182P probably damaging Het
Cyp2b10 T A 7: 25,915,496 Y309* probably null Het
Dcaf5 T C 12: 80,339,084 E756G probably benign Het
Dctn1 A T 6: 83,199,771 Q1231L possibly damaging Het
Dennd1c T A 17: 57,066,428 R682* probably null Het
Eml6 C A 11: 29,777,052 E1319* probably null Het
Erap1 T C 13: 74,690,647 I904T probably damaging Het
Eri1 A T 8: 35,476,519 I207N possibly damaging Het
Farp1 G A 14: 121,277,057 A933T probably damaging Het
Fcna T A 2: 25,625,341 Q210L probably benign Het
Fhad1 A T 4: 141,916,067 probably null Het
Fut8 T G 12: 77,393,829 Y197D probably damaging Het
Garem1 G A 18: 21,129,768 T663I probably benign Het
Gfm2 T C 13: 97,165,038 S450P probably damaging Het
Gstk1 T G 6: 42,246,004 probably benign Het
Helz2 C T 2: 181,237,417 A803T probably damaging Het
Igsf9 T A 1: 172,491,888 I280N probably damaging Het
Klhl10 A G 11: 100,445,843 K219E probably benign Het
L3mbtl4 T A 17: 68,461,563 V222D probably damaging Het
Lrrc9 A T 12: 72,499,679 N1214Y probably damaging Het
Ltbp2 C T 12: 84,793,640 E1051K possibly damaging Het
Mettl17 T C 14: 51,884,983 F13S probably benign Het
Mettl24 C A 10: 40,683,417 A21D possibly damaging Het
Mfsd6l T A 11: 68,556,505 C61S probably benign Het
Mob4 T G 1: 55,152,740 D204E probably benign Het
Mtus1 C G 8: 41,083,152 R509T probably damaging Het
Nsrp1 T C 11: 77,050,618 N88S probably benign Het
Olfr117 T A 17: 37,660,078 H85L probably benign Het
Olfr623 T C 7: 103,660,471 T260A probably benign Het
Olfr791 T A 10: 129,526,580 Y118N probably damaging Het
Olfr975 C T 9: 39,950,112 V220I probably benign Het
Parg A G 14: 32,202,451 N69S probably benign Het
Pcdh9 A C 14: 93,887,941 N264K probably damaging Het
Pcdhb22 G T 18: 37,520,562 L694F probably damaging Het
Pcnt T C 10: 76,412,501 E928G probably damaging Het
Pdzk1 G A 3: 96,868,435 G373D probably benign Het
Pea15a A G 1: 172,199,173 I89T probably damaging Het
Phc1 T A 6: 122,337,005 probably benign Het
Pikfyve T A 1: 65,196,741 C191S probably damaging Het
Pitpnm1 T A 19: 4,108,130 D573E probably damaging Het
Pld5 A G 1: 176,274,884 probably benign Het
Plscr2 A T 9: 92,291,077 N89I possibly damaging Het
Pm20d2 A C 4: 33,179,293 N315K probably damaging Het
Pnpla1 T A 17: 28,878,544 M228K probably benign Het
Prim2 T C 1: 33,670,136 probably benign Het
Ralgapa2 A G 2: 146,405,067 probably benign Het
Rgs22 G T 15: 36,050,148 H719N probably benign Het
Ror2 C T 13: 53,118,844 D250N probably damaging Het
Saal1 A G 7: 46,699,647 V281A probably benign Het
Selenof A T 3: 144,590,650 K94N probably damaging Het
Slamf9 T A 1: 172,477,264 C148* probably null Het
Slc4a7 T C 14: 14,772,699 probably null Het
Slco1a5 A G 6: 142,234,705 I657T probably benign Het
St3gal2 A T 8: 110,957,848 H46L probably benign Het
Sucnr1 T G 3: 60,086,648 M199R probably damaging Het
Taok1 T A 11: 77,553,674 E525V probably null Het
Tbc1d10c T A 19: 4,185,446 E298V probably damaging Het
Tll2 T A 19: 41,130,512 H259L probably damaging Het
Tpcn1 A T 5: 120,553,489 F300Y probably damaging Het
Uba6 T A 5: 86,131,338 I642L probably benign Het
Ubqln5 T A 7: 104,129,622 probably benign Het
Vmn1r27 A T 6: 58,215,842 L9Q possibly damaging Het
Vmn2r100 C T 17: 19,521,410 T128I probably benign Het
Vmn2r109 C T 17: 20,541,232 G621D probably benign Het
Vmn2r49 C T 7: 9,986,425 D380N probably benign Het
Vps13a C T 19: 16,677,992 V1891I probably benign Het
Wbp2 G T 11: 116,080,637 Y147* probably null Het
Wdr46 T A 17: 33,941,836 N191K probably benign Het
Wdr46 T C 17: 33,949,399 probably benign Het
Wnt2 A C 6: 18,023,286 F121L probably benign Het
Xpnpep1 T A 19: 53,014,622 D100V probably benign Het
Xpo4 T C 14: 57,590,102 Y879C probably damaging Het
Zswim4 A T 8: 84,212,319 V978D probably damaging Het
Other mutations in Nlrp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Nlrp4a APN 7 26449985 missense possibly damaging 0.51
IGL00972:Nlrp4a APN 7 26457048 missense probably benign
IGL01081:Nlrp4a APN 7 26449829 missense probably benign 0.06
IGL01788:Nlrp4a APN 7 26454067 missense probably benign 0.17
IGL02001:Nlrp4a APN 7 26449969 missense probably benign 0.01
IGL02070:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02175:Nlrp4a APN 7 26475097 missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26459692 missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02197:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02200:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02202:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02207:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02237:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02240:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02658:Nlrp4a APN 7 26449713 missense probably benign 0.43
IGL02743:Nlrp4a APN 7 26459815 splice site probably benign
IGL02960:Nlrp4a APN 7 26449730 missense probably benign 0.05
IGL03064:Nlrp4a APN 7 26449509 missense probably benign 0.23
IGL03276:Nlrp4a APN 7 26464190 missense probably damaging 1.00
D3080:Nlrp4a UTSW 7 26444341 missense probably benign 0.22
P0019:Nlrp4a UTSW 7 26449637 missense probably damaging 1.00
R0020:Nlrp4a UTSW 7 26450372 missense probably damaging 1.00
R0240:Nlrp4a UTSW 7 26462516 missense probably benign 0.00
R0240:Nlrp4a UTSW 7 26462516 missense probably benign 0.00
R0372:Nlrp4a UTSW 7 26449232 splice site probably benign
R0466:Nlrp4a UTSW 7 26462620 splice site probably benign
R0544:Nlrp4a UTSW 7 26457130 missense probably benign 0.00
R1006:Nlrp4a UTSW 7 26453467 missense probably benign 0.30
R1072:Nlrp4a UTSW 7 26444435 missense probably damaging 1.00
R1432:Nlrp4a UTSW 7 26464197 frame shift probably null
R1655:Nlrp4a UTSW 7 26449651 missense possibly damaging 0.56
R1696:Nlrp4a UTSW 7 26450534 missense probably damaging 1.00
R2041:Nlrp4a UTSW 7 26450186 missense probably damaging 0.97
R2091:Nlrp4a UTSW 7 26450153 missense probably damaging 1.00
R2163:Nlrp4a UTSW 7 26453397 missense probably benign 0.00
R2174:Nlrp4a UTSW 7 26449424 missense probably damaging 1.00
R2319:Nlrp4a UTSW 7 26449894 missense probably benign 0.10
R2358:Nlrp4a UTSW 7 26464198 missense probably benign 0.03
R2680:Nlrp4a UTSW 7 26449230 intron probably null
R3812:Nlrp4a UTSW 7 26449693 missense probably benign
R4114:Nlrp4a UTSW 7 26449940 missense probably damaging 1.00
R4664:Nlrp4a UTSW 7 26449518 nonsense probably null
R4676:Nlrp4a UTSW 7 26450229 missense probably damaging 1.00
R4708:Nlrp4a UTSW 7 26464108 missense probably benign 0.00
R4728:Nlrp4a UTSW 7 26475090 missense probably benign 0.24
R4815:Nlrp4a UTSW 7 26450808 missense probably benign 0.00
R5007:Nlrp4a UTSW 7 26462480 missense probably damaging 0.99
R5253:Nlrp4a UTSW 7 26450492 missense probably benign 0.00
R5262:Nlrp4a UTSW 7 26459811 critical splice donor site probably null
R5441:Nlrp4a UTSW 7 26454153 missense probably damaging 1.00
R5639:Nlrp4a UTSW 7 26457030 missense probably benign 0.02
R5641:Nlrp4a UTSW 7 26450164 missense probably damaging 1.00
R5771:Nlrp4a UTSW 7 26453389 missense probably damaging 1.00
R6312:Nlrp4a UTSW 7 26449396 missense probably benign 0.11
R7131:Nlrp4a UTSW 7 26449833 missense probably benign 0.21
R7149:Nlrp4a UTSW 7 26450438 missense probably benign 0.00
R7348:Nlrp4a UTSW 7 26444273 missense probably damaging 1.00
R7384:Nlrp4a UTSW 7 26449538 missense not run
R7548:Nlrp4a UTSW 7 26450179 missense probably damaging 1.00
R7566:Nlrp4a UTSW 7 26449245 critical splice acceptor site probably null
T0975:Nlrp4a UTSW 7 26449637 missense probably damaging 1.00
X0022:Nlrp4a UTSW 7 26444342 missense probably damaging 0.99
Z1088:Nlrp4a UTSW 7 26454163 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACATCCCCATACTACTGGAC -3'
(R):5'- GGTGTCATCGTCCATCTCAAAC -3'

Sequencing Primer
(F):5'- TCCCCATACTACTGGACATTGGAATG -3'
(R):5'- AAACAGCTTCATGCCATCTATCTG -3'
Posted On2016-03-01