Incidental Mutation 'R4831:Lrrc9'
ID372831
Institutional Source Beutler Lab
Gene Symbol Lrrc9
Ensembl Gene ENSMUSG00000021090
Gene Nameleucine rich repeat containing 9
Synonyms4930432K16Rik, 4921529O18Rik
MMRRC Submission 042447-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R4831 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location72441866-72530750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72499679 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 1214 (N1214Y)
Ref Sequence ENSEMBL: ENSMUSP00000152125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161284] [ENSMUST00000162159] [ENSMUST00000220791] [ENSMUST00000221360]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161195
Predicted Effect probably benign
Transcript: ENSMUST00000161284
SMART Domains Protein: ENSMUSP00000124602
Gene: ENSMUSG00000021090

DomainStartEndE-ValueType
Pfam:LRR_4 77 118 2.8e-11 PFAM
LRR 119 140 8.49e1 SMART
LRR 141 164 2.27e1 SMART
LRR 165 187 2.09e2 SMART
LRRcap 210 228 6.12e1 SMART
low complexity region 373 384 N/A INTRINSIC
low complexity region 424 436 N/A INTRINSIC
LRR 706 727 1.41e2 SMART
LRR 728 749 6.78e1 SMART
LRR 750 773 7.17e1 SMART
LRRcap 793 811 2.26e2 SMART
LRR 943 966 2.67e-1 SMART
LRR 967 992 1.22e1 SMART
LRRcap 1031 1049 4.37e0 SMART
low complexity region 1109 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162159
AA Change: N1213Y

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124394
Gene: ENSMUSG00000021090
AA Change: N1213Y

DomainStartEndE-ValueType
LRR 53 74 5.39e2 SMART
LRR 75 96 1.14e2 SMART
LRR 97 118 7.9e-4 SMART
LRR 119 140 2.75e-3 SMART
LRR 141 164 2.27e1 SMART
LRR 164 185 1.87e1 SMART
LRRcap 210 228 6.12e1 SMART
low complexity region 373 384 N/A INTRINSIC
low complexity region 424 436 N/A INTRINSIC
LRR 705 726 1.41e2 SMART
LRR 727 748 6.78e1 SMART
LRR 749 771 1.37e1 SMART
LRRcap 792 810 2.26e2 SMART
LRR 898 919 2.62e1 SMART
LRR 920 941 5.17e1 SMART
LRR 942 965 2.67e-1 SMART
LRR 966 991 1.22e1 SMART
LRR 1013 1032 4.42e2 SMART
LRRcap 1030 1048 4.37e0 SMART
low complexity region 1108 1119 N/A INTRINSIC
LRR 1128 1150 2.4e1 SMART
LRR 1191 1209 5.7e2 SMART
LRR 1215 1236 1.03e-2 SMART
LRR 1237 1260 8.48e0 SMART
LRR 1283 1304 2.67e-1 SMART
Blast:LRR 1308 1333 4e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000220791
AA Change: N127Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000221360
AA Change: N1214Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.1778 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (96/97)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik C T 11: 69,900,577 V59I possibly damaging Het
4930544M13Rik T G 13: 114,607,647 noncoding transcript Het
Abca13 A T 11: 9,542,077 K4373* probably null Het
Abtb2 A T 2: 103,683,475 T410S probably benign Het
Adamts13 T C 2: 26,983,130 probably null Het
Ahnak2 C G 12: 112,775,749 D630H probably damaging Het
Aox3 T C 1: 58,152,566 S426P probably damaging Het
Armc4 G T 18: 7,222,564 H568Q possibly damaging Het
Atxn10 C T 15: 85,387,059 S266F probably benign Het
B4galnt4 T A 7: 141,064,557 probably null Het
B4galnt4 G T 7: 141,067,721 M407I probably damaging Het
Bclaf1 T A 10: 20,322,126 probably benign Het
C4b C T 17: 34,736,890 probably null Het
Cdc42bpg T C 19: 6,311,335 F297S probably damaging Het
Cdh10 A T 15: 19,013,578 T755S probably benign Het
Ceacam12 T A 7: 18,077,380 probably null Het
Cfap65 C A 1: 74,917,295 V1042F possibly damaging Het
Cfap77 T C 2: 28,985,832 I89V probably benign Het
Cfh T C 1: 140,086,387 D688G probably benign Het
Clip1 C G 5: 123,583,601 A1182P probably damaging Het
Cyp2b10 T A 7: 25,915,496 Y309* probably null Het
Dcaf5 T C 12: 80,339,084 E756G probably benign Het
Dctn1 A T 6: 83,199,771 Q1231L possibly damaging Het
Dennd1c T A 17: 57,066,428 R682* probably null Het
Eml6 C A 11: 29,777,052 E1319* probably null Het
Erap1 T C 13: 74,690,647 I904T probably damaging Het
Eri1 A T 8: 35,476,519 I207N possibly damaging Het
Farp1 G A 14: 121,277,057 A933T probably damaging Het
Fcna T A 2: 25,625,341 Q210L probably benign Het
Fhad1 A T 4: 141,916,067 probably null Het
Fut8 T G 12: 77,393,829 Y197D probably damaging Het
Garem1 G A 18: 21,129,768 T663I probably benign Het
Gfm2 T C 13: 97,165,038 S450P probably damaging Het
Gstk1 T G 6: 42,246,004 probably benign Het
Helz2 C T 2: 181,237,417 A803T probably damaging Het
Igsf9 T A 1: 172,491,888 I280N probably damaging Het
Klhl10 A G 11: 100,445,843 K219E probably benign Het
L3mbtl4 T A 17: 68,461,563 V222D probably damaging Het
Ltbp2 C T 12: 84,793,640 E1051K possibly damaging Het
Mettl17 T C 14: 51,884,983 F13S probably benign Het
Mettl24 C A 10: 40,683,417 A21D possibly damaging Het
Mfsd6l T A 11: 68,556,505 C61S probably benign Het
Mob4 T G 1: 55,152,740 D204E probably benign Het
Mtus1 C G 8: 41,083,152 R509T probably damaging Het
Nlrp4a T A 7: 26,450,419 F484I possibly damaging Het
Nsrp1 T C 11: 77,050,618 N88S probably benign Het
Olfr117 T A 17: 37,660,078 H85L probably benign Het
Olfr623 T C 7: 103,660,471 T260A probably benign Het
Olfr791 T A 10: 129,526,580 Y118N probably damaging Het
Olfr975 C T 9: 39,950,112 V220I probably benign Het
Parg A G 14: 32,202,451 N69S probably benign Het
Pcdh9 A C 14: 93,887,941 N264K probably damaging Het
Pcdhb22 G T 18: 37,520,562 L694F probably damaging Het
Pcnt T C 10: 76,412,501 E928G probably damaging Het
Pdzk1 G A 3: 96,868,435 G373D probably benign Het
Pea15a A G 1: 172,199,173 I89T probably damaging Het
Phc1 T A 6: 122,337,005 probably benign Het
Pikfyve T A 1: 65,196,741 C191S probably damaging Het
Pitpnm1 T A 19: 4,108,130 D573E probably damaging Het
Pld5 A G 1: 176,274,884 probably benign Het
Plscr2 A T 9: 92,291,077 N89I possibly damaging Het
Pm20d2 A C 4: 33,179,293 N315K probably damaging Het
Pnpla1 T A 17: 28,878,544 M228K probably benign Het
Prim2 T C 1: 33,670,136 probably benign Het
Ralgapa2 A G 2: 146,405,067 probably benign Het
Rgs22 G T 15: 36,050,148 H719N probably benign Het
Ror2 C T 13: 53,118,844 D250N probably damaging Het
Saal1 A G 7: 46,699,647 V281A probably benign Het
Selenof A T 3: 144,590,650 K94N probably damaging Het
Slamf9 T A 1: 172,477,264 C148* probably null Het
Slc4a7 T C 14: 14,772,699 probably null Het
Slco1a5 A G 6: 142,234,705 I657T probably benign Het
St3gal2 A T 8: 110,957,848 H46L probably benign Het
Sucnr1 T G 3: 60,086,648 M199R probably damaging Het
Taok1 T A 11: 77,553,674 E525V probably null Het
Tbc1d10c T A 19: 4,185,446 E298V probably damaging Het
Tll2 T A 19: 41,130,512 H259L probably damaging Het
Tpcn1 A T 5: 120,553,489 F300Y probably damaging Het
Uba6 T A 5: 86,131,338 I642L probably benign Het
Ubqln5 T A 7: 104,129,622 probably benign Het
Vmn1r27 A T 6: 58,215,842 L9Q possibly damaging Het
Vmn2r100 C T 17: 19,521,410 T128I probably benign Het
Vmn2r109 C T 17: 20,541,232 G621D probably benign Het
Vmn2r49 C T 7: 9,986,425 D380N probably benign Het
Vps13a C T 19: 16,677,992 V1891I probably benign Het
Wbp2 G T 11: 116,080,637 Y147* probably null Het
Wdr46 T A 17: 33,941,836 N191K probably benign Het
Wdr46 T C 17: 33,949,399 probably benign Het
Wnt2 A C 6: 18,023,286 F121L probably benign Het
Xpnpep1 T A 19: 53,014,622 D100V probably benign Het
Xpo4 T C 14: 57,590,102 Y879C probably damaging Het
Zswim4 A T 8: 84,212,319 V978D probably damaging Het
Other mutations in Lrrc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Lrrc9 APN 12 72486243 missense possibly damaging 0.63
IGL00843:Lrrc9 APN 12 72463417 missense possibly damaging 0.78
IGL01923:Lrrc9 APN 12 72510412 missense possibly damaging 0.93
IGL02027:Lrrc9 APN 12 72470334 splice site probably benign
IGL02271:Lrrc9 APN 12 72510381 missense probably benign 0.06
IGL02398:Lrrc9 APN 12 72466903 missense probably benign
IGL02795:Lrrc9 APN 12 72478768 missense probably damaging 1.00
IGL02931:Lrrc9 APN 12 72454149 missense probably damaging 1.00
IGL03257:Lrrc9 APN 12 72449768 missense probably benign
BB006:Lrrc9 UTSW 12 72486297 missense possibly damaging 0.92
BB016:Lrrc9 UTSW 12 72486297 missense possibly damaging 0.92
IGL02799:Lrrc9 UTSW 12 72506404 missense probably damaging 1.00
R0172:Lrrc9 UTSW 12 72463486 missense possibly damaging 0.50
R0315:Lrrc9 UTSW 12 72456028 missense probably damaging 0.96
R0492:Lrrc9 UTSW 12 72478763 missense possibly damaging 0.47
R0617:Lrrc9 UTSW 12 72483014 missense probably damaging 1.00
R0639:Lrrc9 UTSW 12 72486288 missense probably damaging 1.00
R0987:Lrrc9 UTSW 12 72510382 missense probably benign 0.00
R1325:Lrrc9 UTSW 12 72497104 missense probably damaging 0.99
R1465:Lrrc9 UTSW 12 72500759 missense probably benign 0.05
R1465:Lrrc9 UTSW 12 72500759 missense probably benign 0.05
R1479:Lrrc9 UTSW 12 72460825 nonsense probably null
R1564:Lrrc9 UTSW 12 72487053 missense probably damaging 1.00
R1626:Lrrc9 UTSW 12 72495661 unclassified probably null
R1632:Lrrc9 UTSW 12 72460020 splice site probably null
R1715:Lrrc9 UTSW 12 72477299 missense probably damaging 1.00
R1743:Lrrc9 UTSW 12 72456117 missense probably damaging 1.00
R1779:Lrrc9 UTSW 12 72455998 nonsense probably null
R1866:Lrrc9 UTSW 12 72497138 missense probably damaging 0.97
R1878:Lrrc9 UTSW 12 72476164 critical splice donor site probably null
R1990:Lrrc9 UTSW 12 72497861 missense probably damaging 0.99
R2361:Lrrc9 UTSW 12 72463470 missense possibly damaging 0.52
R3752:Lrrc9 UTSW 12 72460806 nonsense probably null
R3833:Lrrc9 UTSW 12 72482991 missense probably damaging 1.00
R4134:Lrrc9 UTSW 12 72466966 missense probably benign 0.00
R4651:Lrrc9 UTSW 12 72477386 missense probably damaging 1.00
R4652:Lrrc9 UTSW 12 72477386 missense probably damaging 1.00
R4659:Lrrc9 UTSW 12 72470264 missense probably damaging 1.00
R4857:Lrrc9 UTSW 12 72499692 missense possibly damaging 0.94
R5017:Lrrc9 UTSW 12 72506325 missense possibly damaging 0.86
R5163:Lrrc9 UTSW 12 72449389 missense probably damaging 1.00
R5279:Lrrc9 UTSW 12 72495594 missense possibly damaging 0.80
R5434:Lrrc9 UTSW 12 72454088 missense probably damaging 0.98
R5783:Lrrc9 UTSW 12 72456053 missense possibly damaging 0.62
R6021:Lrrc9 UTSW 12 72469231 missense probably damaging 0.97
R6214:Lrrc9 UTSW 12 72459853 missense probably damaging 1.00
R6255:Lrrc9 UTSW 12 72487023 missense probably benign 0.33
R6538:Lrrc9 UTSW 12 72500929 missense probably benign 0.08
R6563:Lrrc9 UTSW 12 72486395 splice site probably null
R6672:Lrrc9 UTSW 12 72473936 missense possibly damaging 0.88
R6919:Lrrc9 UTSW 12 72506393 missense probably benign 0.01
R6929:Lrrc9 UTSW 12 72450772 missense probably benign 0.41
R7092:Lrrc9 UTSW 12 72463464 missense possibly damaging 0.81
R7150:Lrrc9 UTSW 12 72466952 missense probably benign 0.00
R7338:Lrrc9 UTSW 12 72463531 intron probably null
R7398:Lrrc9 UTSW 12 72500816 missense probably damaging 0.98
R7477:Lrrc9 UTSW 12 72503527 critical splice donor site probably null
R7501:Lrrc9 UTSW 12 72449716 missense probably damaging 1.00
R7542:Lrrc9 UTSW 12 72506320 missense probably damaging 0.96
R7816:Lrrc9 UTSW 12 72495692 missense probably damaging 1.00
R7870:Lrrc9 UTSW 12 72486190 missense probably damaging 0.99
R7929:Lrrc9 UTSW 12 72486297 missense possibly damaging 0.92
R8042:Lrrc9 UTSW 12 72460906 missense probably benign 0.02
R8108:Lrrc9 UTSW 12 72454059 missense probably damaging 1.00
R8192:Lrrc9 UTSW 12 72449389 missense probably damaging 1.00
R8244:Lrrc9 UTSW 12 72499610 missense probably benign 0.22
X0025:Lrrc9 UTSW 12 72497060 missense probably damaging 1.00
Z1176:Lrrc9 UTSW 12 72477393 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATACCTCTGACTGCCTTTTATGA -3'
(R):5'- AGGGACTGACTTATGGGGAC -3'

Sequencing Primer
(F):5'- CTGACTGCCTTTTATGATAAAATTGC -3'
(R):5'- CAAGGGAGATAGAGAATACACACAAC -3'
Posted On2016-03-01