Mutagenetix > Incidental Mutation

Incidental Mutation 'R4831:Garem1'

372857

Institutional Source

Beutler Lab

Gene Symbol

Garem1

Ensembl Gene

ENSMUSG00000042680

Gene Name

GRB2 associated regulator of MAPK1 subtype 1

Synonyms

Garem, Fam59a, LOC381126

MMRRC Submission

042447-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R4831 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21127201-21300138 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 21129768 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 663 (T663I)

Ref Sequence

ENSEMBL: ENSMUSP00000048914 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049260]

AlphaFold

Q3UFT3

Predicted Effect

probably benign
Transcript: ENSMUST00000049260
AA Change: T663I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000048914
Gene: ENSMUSG00000042680
AA Change: T663I

Domain	Start	End	E-Value	Type
Pfam:CABIT	32	318	3.4e-79	PFAM
low complexity region	484	499	N/A	INTRINSIC
low complexity region	512	518	N/A	INTRINSIC
PDB:2DKZ\|A	795	874	2e-40	PDB
Blast:SAM	808	875	2e-36	BLAST
SCOP:d1kw4a_	812	873	4e-4	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

99% (96/97)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein which functions in the epidermal growth factor (EGF) receptor-mediated signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810408A11Rik	C	T	11: 69,900,577	V59I	possibly damaging	Het
4930544M13Rik	T	G	13: 114,607,647		noncoding transcript	Het
Abca13	A	T	11: 9,542,077	K4373*	probably null	Het
Abtb2	A	T	2: 103,683,475	T410S	probably benign	Het
Adamts13	T	C	2: 26,983,130		probably null	Het
Ahnak2	C	G	12: 112,775,749	D630H	probably damaging	Het
Aox3	T	C	1: 58,152,566	S426P	probably damaging	Het
Armc4	G	T	18: 7,222,564	H568Q	possibly damaging	Het
Atxn10	C	T	15: 85,387,059	S266F	probably benign	Het
B4galnt4	T	A	7: 141,064,557		probably null	Het
B4galnt4	G	T	7: 141,067,721	M407I	probably damaging	Het
Bclaf1	T	A	10: 20,322,126		probably benign	Het
C4b	C	T	17: 34,736,890		probably null	Het
Cdc42bpg	T	C	19: 6,311,335	F297S	probably damaging	Het
Cdh10	A	T	15: 19,013,578	T755S	probably benign	Het
Ceacam12	T	A	7: 18,077,380		probably null	Het
Cfap65	C	A	1: 74,917,295	V1042F	possibly damaging	Het
Cfap77	T	C	2: 28,985,832	I89V	probably benign	Het
Cfh	T	C	1: 140,086,387	D688G	probably benign	Het
Clip1	C	G	5: 123,583,601	A1182P	probably damaging	Het
Cyp2b10	T	A	7: 25,915,496	Y309*	probably null	Het
Dcaf5	T	C	12: 80,339,084	E756G	probably benign	Het
Dctn1	A	T	6: 83,199,771	Q1231L	possibly damaging	Het
Dennd1c	T	A	17: 57,066,428	R682*	probably null	Het
Eml6	C	A	11: 29,777,052	E1319*	probably null	Het
Erap1	T	C	13: 74,690,647	I904T	probably damaging	Het
Eri1	A	T	8: 35,476,519	I207N	possibly damaging	Het
Farp1	G	A	14: 121,277,057	A933T	probably damaging	Het
Fcna	T	A	2: 25,625,341	Q210L	probably benign	Het
Fhad1	A	T	4: 141,916,067		probably null	Het
Fut8	T	G	12: 77,393,829	Y197D	probably damaging	Het
Gfm2	T	C	13: 97,165,038	S450P	probably damaging	Het
Gstk1	T	G	6: 42,246,004		probably benign	Het
Helz2	C	T	2: 181,237,417	A803T	probably damaging	Het
Igsf9	T	A	1: 172,491,888	I280N	probably damaging	Het
Klhl10	A	G	11: 100,445,843	K219E	probably benign	Het
L3mbtl4	T	A	17: 68,461,563	V222D	probably damaging	Het
Lrrc9	A	T	12: 72,499,679	N1214Y	probably damaging	Het
Ltbp2	C	T	12: 84,793,640	E1051K	possibly damaging	Het
Mettl17	T	C	14: 51,884,983	F13S	probably benign	Het
Mettl24	C	A	10: 40,683,417	A21D	possibly damaging	Het
Mfsd6l	T	A	11: 68,556,505	C61S	probably benign	Het
Mob4	T	G	1: 55,152,740	D204E	probably benign	Het
Mtus1	C	G	8: 41,083,152	R509T	probably damaging	Het
Nlrp4a	T	A	7: 26,450,419	F484I	possibly damaging	Het
Nsrp1	T	C	11: 77,050,618	N88S	probably benign	Het
Olfr117	T	A	17: 37,660,078	H85L	probably benign	Het
Olfr623	T	C	7: 103,660,471	T260A	probably benign	Het
Olfr791	T	A	10: 129,526,580	Y118N	probably damaging	Het
Olfr975	C	T	9: 39,950,112	V220I	probably benign	Het
Parg	A	G	14: 32,202,451	N69S	probably benign	Het
Pcdh9	A	C	14: 93,887,941	N264K	probably damaging	Het
Pcdhb22	G	T	18: 37,520,562	L694F	probably damaging	Het
Pcnt	T	C	10: 76,412,501	E928G	probably damaging	Het
Pdzk1	G	A	3: 96,868,435	G373D	probably benign	Het
Pea15a	A	G	1: 172,199,173	I89T	probably damaging	Het
Phc1	T	A	6: 122,337,005		probably benign	Het
Pikfyve	T	A	1: 65,196,741	C191S	probably damaging	Het
Pitpnm1	T	A	19: 4,108,130	D573E	probably damaging	Het
Pld5	A	G	1: 176,274,884		probably benign	Het
Plscr2	A	T	9: 92,291,077	N89I	possibly damaging	Het
Pm20d2	A	C	4: 33,179,293	N315K	probably damaging	Het
Pnpla1	T	A	17: 28,878,544	M228K	probably benign	Het
Prim2	T	C	1: 33,670,136		probably benign	Het
Ralgapa2	A	G	2: 146,405,067		probably benign	Het
Rgs22	G	T	15: 36,050,148	H719N	probably benign	Het
Ror2	C	T	13: 53,118,844	D250N	probably damaging	Het
Saal1	A	G	7: 46,699,647	V281A	probably benign	Het
Selenof	A	T	3: 144,590,650	K94N	probably damaging	Het
Slamf9	T	A	1: 172,477,264	C148*	probably null	Het
Slc4a7	T	C	14: 14,772,699		probably null	Het
Slco1a5	A	G	6: 142,234,705	I657T	probably benign	Het
St3gal2	A	T	8: 110,957,848	H46L	probably benign	Het
Sucnr1	T	G	3: 60,086,648	M199R	probably damaging	Het
Taok1	T	A	11: 77,553,674	E525V	probably null	Het
Tbc1d10c	T	A	19: 4,185,446	E298V	probably damaging	Het
Tll2	T	A	19: 41,130,512	H259L	probably damaging	Het
Tpcn1	A	T	5: 120,553,489	F300Y	probably damaging	Het
Uba6	T	A	5: 86,131,338	I642L	probably benign	Het
Ubqln5	T	A	7: 104,129,622		probably benign	Het
Vmn1r27	A	T	6: 58,215,842	L9Q	possibly damaging	Het
Vmn2r100	C	T	17: 19,521,410	T128I	probably benign	Het
Vmn2r109	C	T	17: 20,541,232	G621D	probably benign	Het
Vmn2r49	C	T	7: 9,986,425	D380N	probably benign	Het
Vps13a	C	T	19: 16,677,992	V1891I	probably benign	Het
Wbp2	G	T	11: 116,080,637	Y147*	probably null	Het
Wdr46	T	A	17: 33,941,836	N191K	probably benign	Het
Wdr46	T	C	17: 33,949,399		probably benign	Het
Wnt2	A	C	6: 18,023,286	F121L	probably benign	Het
Xpnpep1	T	A	19: 53,014,622	D100V	probably benign	Het
Xpo4	T	C	14: 57,590,102	Y879C	probably damaging	Het
Zswim4	A	T	8: 84,212,319	V978D	probably damaging	Het

Other mutations in Garem1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Garem1	APN	18	21148657	missense	probably damaging	1.00
IGL01588:Garem1	APN	18	21129797	missense	probably damaging	0.99
IGL02171:Garem1	APN	18	21129241	missense	probably damaging	0.98
IGL02270:Garem1	APN	18	21148450	missense	probably damaging	1.00
IGL03149:Garem1	APN	18	21131466	missense	probably damaging	1.00
R0136:Garem1	UTSW	18	21129991	missense	probably damaging	0.96
R0285:Garem1	UTSW	18	21129612	missense	probably benign
R0361:Garem1	UTSW	18	21299744	nonsense	probably null
R1068:Garem1	UTSW	18	21168755	missense	probably benign	0.00
R1537:Garem1	UTSW	18	21168874	splice site	probably null
R1726:Garem1	UTSW	18	21148262	missense	probably damaging	0.99
R1826:Garem1	UTSW	18	21129452	missense	probably benign	0.00
R2140:Garem1	UTSW	18	21129374	missense	probably damaging	1.00
R3714:Garem1	UTSW	18	21148890	missense	probably damaging	1.00
R3937:Garem1	UTSW	18	21148806	nonsense	probably null
R4362:Garem1	UTSW	18	21236115	missense	possibly damaging	0.62
R4441:Garem1	UTSW	18	21168750	missense	possibly damaging	0.92
R4747:Garem1	UTSW	18	21129943	missense	probably benign
R4814:Garem1	UTSW	18	21148116	missense	probably damaging	1.00
R4838:Garem1	UTSW	18	21147893	missense	probably benign	0.00
R5805:Garem1	UTSW	18	21148435	missense	probably benign	0.04
R5963:Garem1	UTSW	18	21129430	missense	probably benign	0.45
R5982:Garem1	UTSW	18	21148351	missense	possibly damaging	0.64
R6134:Garem1	UTSW	18	21129824	missense	probably benign	0.00
R6242:Garem1	UTSW	18	21129172	missense	possibly damaging	0.72
R6453:Garem1	UTSW	18	21148739	missense	probably damaging	0.99
R6485:Garem1	UTSW	18	21129837	missense	probably benign	0.00
R6596:Garem1	UTSW	18	21148739	missense	probably damaging	0.99
R6662:Garem1	UTSW	18	21148247	missense	probably benign	0.45
R6883:Garem1	UTSW	18	21129712	missense	probably benign
R6937:Garem1	UTSW	18	21147770	missense	probably benign	0.00
R7027:Garem1	UTSW	18	21129994	missense	probably benign
R7256:Garem1	UTSW	18	21148754	missense	probably damaging	1.00
R7534:Garem1	UTSW	18	21299916	start gained	probably benign
R7620:Garem1	UTSW	18	21129841	missense	probably benign
R7869:Garem1	UTSW	18	21299700	missense	probably damaging	1.00
R7963:Garem1	UTSW	18	21148787	missense	probably damaging	0.98
R8058:Garem1	UTSW	18	21148564	missense	probably damaging	1.00
R8953:Garem1	UTSW	18	21131331	critical splice donor site	probably null
R9273:Garem1	UTSW	18	21148217	missense	probably damaging	0.99
R9411:Garem1	UTSW	18	21236000	critical splice donor site	probably null
R9475:Garem1	UTSW	18	21148313	missense	probably benign	0.00
R9789:Garem1	UTSW	18	21129928	missense	possibly damaging	0.81
Z1176:Garem1	UTSW	18	21129792	missense	probably damaging	1.00
Z1176:Garem1	UTSW	18	21148325	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACGCTCTGCTTGGTCATG -3'
(R):5'- GATACAAGTCCTCCCAACAGTG -3'

Sequencing Primer
(F):5'- GCCAGCTGCAAAGGAGTTGTC -3'
(R):5'- TGAAGAGTGACTCTGTGGACCC -3'

Posted On

2016-03-01