Incidental Mutation 'R4831:Xpnpep1'
ID 372864
Institutional Source Beutler Lab
Gene Symbol Xpnpep1
Ensembl Gene ENSMUSG00000025027
Gene Name X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Synonyms D230045I08Rik
MMRRC Submission 042447-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4831 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 52919710-53027093 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 53003053 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 100 (D100V)
Ref Sequence ENSEMBL: ENSMUSP00000138250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182097] [ENSMUST00000182500] [ENSMUST00000183108] [ENSMUST00000183274]
AlphaFold Q6P1B1
Predicted Effect probably benign
Transcript: ENSMUST00000182097
AA Change: D57V

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000138473
Gene: ENSMUSG00000025027
AA Change: D57V

DomainStartEndE-ValueType
Pfam:Creatinase_N 9 119 5.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183188
Predicted Effect probably benign
Transcript: ENSMUST00000183108
AA Change: D100V

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000138250
Gene: ENSMUSG00000025027
AA Change: D100V

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 5.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183274
AA Change: D100V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138233
Gene: ENSMUSG00000025027
AA Change: D100V

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 1.9e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184510
Meta Mutation Damage Score 0.1305 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (96/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of a metalloaminopeptidase that catalyzes the cleavage of the N-terminal amino acid adjacent to a proline residue. The gene product may play a role in degradation and maturation of tachykinins, neuropeptides, and peptide hormones. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit pre and postnatal lethality, reduced male survival, growth retardation with decreased body weight, size and length, microcephaly and peptiduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik C T 11: 69,791,403 (GRCm39) V59I possibly damaging Het
4930544M13Rik T G 13: 114,744,183 (GRCm39) noncoding transcript Het
Abca13 A T 11: 9,492,077 (GRCm39) K4373* probably null Het
Abtb2 A T 2: 103,513,820 (GRCm39) T410S probably benign Het
Adamts13 T C 2: 26,873,142 (GRCm39) probably null Het
Ahnak2 C G 12: 112,742,183 (GRCm39) D630H probably damaging Het
Aox3 T C 1: 58,191,725 (GRCm39) S426P probably damaging Het
Atxn10 C T 15: 85,271,260 (GRCm39) S266F probably benign Het
B4galnt4 G T 7: 140,647,634 (GRCm39) M407I probably damaging Het
B4galnt4 T A 7: 140,644,470 (GRCm39) probably null Het
Bclaf1 T A 10: 20,197,872 (GRCm39) probably benign Het
C4b C T 17: 34,955,864 (GRCm39) probably null Het
Cdc42bpg T C 19: 6,361,365 (GRCm39) F297S probably damaging Het
Cdh10 A T 15: 19,013,664 (GRCm39) T755S probably benign Het
Ceacam12 T A 7: 17,811,305 (GRCm39) probably null Het
Cfap65 C A 1: 74,956,454 (GRCm39) V1042F possibly damaging Het
Cfap77 T C 2: 28,875,844 (GRCm39) I89V probably benign Het
Cfh T C 1: 140,014,125 (GRCm39) D688G probably benign Het
Clip1 C G 5: 123,721,664 (GRCm39) A1182P probably damaging Het
Cyp2b10 T A 7: 25,614,921 (GRCm39) Y309* probably null Het
Dcaf5 T C 12: 80,385,858 (GRCm39) E756G probably benign Het
Dctn1 A T 6: 83,176,753 (GRCm39) Q1231L possibly damaging Het
Dennd1c T A 17: 57,373,428 (GRCm39) R682* probably null Het
Eml6 C A 11: 29,727,052 (GRCm39) E1319* probably null Het
Erap1 T C 13: 74,838,766 (GRCm39) I904T probably damaging Het
Eri1 A T 8: 35,943,673 (GRCm39) I207N possibly damaging Het
Farp1 G A 14: 121,514,469 (GRCm39) A933T probably damaging Het
Fcna T A 2: 25,515,353 (GRCm39) Q210L probably benign Het
Fhad1 A T 4: 141,643,378 (GRCm39) probably null Het
Fut8 T G 12: 77,440,603 (GRCm39) Y197D probably damaging Het
Garem1 G A 18: 21,262,825 (GRCm39) T663I probably benign Het
Gfm2 T C 13: 97,301,546 (GRCm39) S450P probably damaging Het
Gstk1 T G 6: 42,222,938 (GRCm39) probably benign Het
Helz2 C T 2: 180,879,210 (GRCm39) A803T probably damaging Het
Igsf9 T A 1: 172,319,455 (GRCm39) I280N probably damaging Het
Klhl10 A G 11: 100,336,669 (GRCm39) K219E probably benign Het
L3mbtl4 T A 17: 68,768,558 (GRCm39) V222D probably damaging Het
Lrrc9 A T 12: 72,546,453 (GRCm39) N1214Y probably damaging Het
Ltbp2 C T 12: 84,840,414 (GRCm39) E1051K possibly damaging Het
Mettl17 T C 14: 52,122,440 (GRCm39) F13S probably benign Het
Mettl24 C A 10: 40,559,413 (GRCm39) A21D possibly damaging Het
Mfsd6l T A 11: 68,447,331 (GRCm39) C61S probably benign Het
Mob4 T G 1: 55,191,899 (GRCm39) D204E probably benign Het
Mtus1 C G 8: 41,536,189 (GRCm39) R509T probably damaging Het
Nlrp4a T A 7: 26,149,844 (GRCm39) F484I possibly damaging Het
Nsrp1 T C 11: 76,941,444 (GRCm39) N88S probably benign Het
Odad2 G T 18: 7,222,564 (GRCm39) H568Q possibly damaging Het
Or10d5 C T 9: 39,861,408 (GRCm39) V220I probably benign Het
Or2g25 T A 17: 37,970,969 (GRCm39) H85L probably benign Het
Or51b6b T C 7: 103,309,678 (GRCm39) T260A probably benign Het
Or6c2 T A 10: 129,362,449 (GRCm39) Y118N probably damaging Het
Parg A G 14: 31,924,408 (GRCm39) N69S probably benign Het
Pcdh9 A C 14: 94,125,377 (GRCm39) N264K probably damaging Het
Pcdhb22 G T 18: 37,653,615 (GRCm39) L694F probably damaging Het
Pcnt T C 10: 76,248,335 (GRCm39) E928G probably damaging Het
Pdzk1 G A 3: 96,775,751 (GRCm39) G373D probably benign Het
Pea15a A G 1: 172,026,740 (GRCm39) I89T probably damaging Het
Phc1 T A 6: 122,313,964 (GRCm39) probably benign Het
Pikfyve T A 1: 65,235,900 (GRCm39) C191S probably damaging Het
Pitpnm1 T A 19: 4,158,130 (GRCm39) D573E probably damaging Het
Pld5 A G 1: 176,102,450 (GRCm39) probably benign Het
Plscr2 A T 9: 92,173,130 (GRCm39) N89I possibly damaging Het
Pm20d2 A C 4: 33,179,293 (GRCm39) N315K probably damaging Het
Pnpla1 T A 17: 29,097,518 (GRCm39) M228K probably benign Het
Prim2 T C 1: 33,709,217 (GRCm39) probably benign Het
Ralgapa2 A G 2: 146,246,987 (GRCm39) probably benign Het
Rgs22 G T 15: 36,050,294 (GRCm39) H719N probably benign Het
Ror2 C T 13: 53,272,880 (GRCm39) D250N probably damaging Het
Saal1 A G 7: 46,349,071 (GRCm39) V281A probably benign Het
Selenof A T 3: 144,296,411 (GRCm39) K94N probably damaging Het
Slamf9 T A 1: 172,304,831 (GRCm39) C148* probably null Het
Slc4a7 T C 14: 14,772,699 (GRCm38) probably null Het
Slco1a5 A G 6: 142,180,431 (GRCm39) I657T probably benign Het
St3gal2 A T 8: 111,684,480 (GRCm39) H46L probably benign Het
Sucnr1 T G 3: 59,994,069 (GRCm39) M199R probably damaging Het
Taok1 T A 11: 77,444,500 (GRCm39) E525V probably null Het
Tbc1d10c T A 19: 4,235,445 (GRCm39) E298V probably damaging Het
Tll2 T A 19: 41,118,951 (GRCm39) H259L probably damaging Het
Tpcn1 A T 5: 120,691,554 (GRCm39) F300Y probably damaging Het
Uba6 T A 5: 86,279,197 (GRCm39) I642L probably benign Het
Ubqln5 T A 7: 103,778,829 (GRCm39) probably benign Het
Vmn1r27 A T 6: 58,192,827 (GRCm39) L9Q possibly damaging Het
Vmn2r100 C T 17: 19,741,672 (GRCm39) T128I probably benign Het
Vmn2r109 C T 17: 20,761,494 (GRCm39) G621D probably benign Het
Vmn2r49 C T 7: 9,720,352 (GRCm39) D380N probably benign Het
Vps13a C T 19: 16,655,356 (GRCm39) V1891I probably benign Het
Wbp2 G T 11: 115,971,463 (GRCm39) Y147* probably null Het
Wdr46 T A 17: 34,160,810 (GRCm39) N191K probably benign Het
Wdr46 T C 17: 34,168,373 (GRCm39) probably benign Het
Wnt2 A C 6: 18,023,285 (GRCm39) F121L probably benign Het
Xpo4 T C 14: 57,827,559 (GRCm39) Y879C probably damaging Het
Zswim4 A T 8: 84,938,948 (GRCm39) V978D probably damaging Het
Other mutations in Xpnpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Xpnpep1 APN 19 52,998,579 (GRCm39) missense probably benign 0.06
IGL01665:Xpnpep1 APN 19 52,985,463 (GRCm39) missense probably benign 0.00
IGL01833:Xpnpep1 APN 19 52,988,824 (GRCm39) missense probably damaging 1.00
IGL02011:Xpnpep1 APN 19 52,990,896 (GRCm39) critical splice donor site probably benign 0.00
IGL03229:Xpnpep1 APN 19 53,013,811 (GRCm39) missense probably benign
IGL03334:Xpnpep1 APN 19 52,998,577 (GRCm39) missense probably damaging 1.00
R0226:Xpnpep1 UTSW 19 52,998,583 (GRCm39) missense probably benign 0.03
R0613:Xpnpep1 UTSW 19 52,994,784 (GRCm39) missense probably damaging 0.97
R0648:Xpnpep1 UTSW 19 52,986,294 (GRCm39) splice site probably benign
R1543:Xpnpep1 UTSW 19 52,980,107 (GRCm39) missense probably benign 0.24
R1553:Xpnpep1 UTSW 19 52,994,769 (GRCm39) missense probably benign 0.00
R1801:Xpnpep1 UTSW 19 52,998,564 (GRCm39) missense probably damaging 1.00
R1853:Xpnpep1 UTSW 19 52,994,641 (GRCm39) missense probably benign 0.01
R2234:Xpnpep1 UTSW 19 53,001,892 (GRCm39) missense probably damaging 1.00
R3797:Xpnpep1 UTSW 19 52,994,773 (GRCm39) missense probably benign 0.28
R3820:Xpnpep1 UTSW 19 52,992,250 (GRCm39) splice site probably benign
R3822:Xpnpep1 UTSW 19 52,992,250 (GRCm39) splice site probably benign
R3925:Xpnpep1 UTSW 19 52,980,128 (GRCm39) missense probably damaging 1.00
R5033:Xpnpep1 UTSW 19 52,994,606 (GRCm39) missense probably benign
R5184:Xpnpep1 UTSW 19 53,001,845 (GRCm39) missense probably benign 0.24
R5468:Xpnpep1 UTSW 19 52,983,950 (GRCm39) missense probably benign 0.01
R5573:Xpnpep1 UTSW 19 52,993,253 (GRCm39) missense probably damaging 1.00
R5876:Xpnpep1 UTSW 19 52,985,439 (GRCm39) missense probably damaging 1.00
R5929:Xpnpep1 UTSW 19 53,001,920 (GRCm39) missense probably damaging 1.00
R6454:Xpnpep1 UTSW 19 52,986,310 (GRCm39) missense possibly damaging 0.91
R6519:Xpnpep1 UTSW 19 53,000,275 (GRCm39) missense possibly damaging 0.90
R7095:Xpnpep1 UTSW 19 53,000,196 (GRCm39) critical splice donor site probably null
R7112:Xpnpep1 UTSW 19 52,998,538 (GRCm39) missense probably benign
R7412:Xpnpep1 UTSW 19 52,994,722 (GRCm39) missense probably benign
R8329:Xpnpep1 UTSW 19 52,990,903 (GRCm39) critical splice donor site probably null
R8431:Xpnpep1 UTSW 19 52,983,937 (GRCm39) missense probably benign 0.04
R9194:Xpnpep1 UTSW 19 53,000,289 (GRCm39) missense possibly damaging 0.68
R9342:Xpnpep1 UTSW 19 52,993,248 (GRCm39) missense probably benign 0.02
R9388:Xpnpep1 UTSW 19 52,993,233 (GRCm39) missense probably damaging 1.00
R9546:Xpnpep1 UTSW 19 52,990,959 (GRCm39) missense probably damaging 1.00
R9746:Xpnpep1 UTSW 19 53,001,892 (GRCm39) missense probably damaging 1.00
RF017:Xpnpep1 UTSW 19 53,020,491 (GRCm39) missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- ACTAAAAGGTGGCGCTGATG -3'
(R):5'- AAGCTTTGTTCTCCAGAGGGG -3'

Sequencing Primer
(F):5'- CTGATGAGCGGATAAAATTACTGCCC -3'
(R):5'- TCTGTTTTCCAGAGCGAG -3'
Posted On 2016-03-01