Incidental Mutation 'R4832:Erbb4'
ID372867
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Nameerb-b2 receptor tyrosine kinase 4
SynonymsHer4, ErbB4
MMRRC Submission 042448-MU
Accession Numbers

Ncbi RefSeq: NM_010154.1; MGI:104771

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4832 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location68032186-69108059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68330238 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 415 (S415G)
Ref Sequence ENSEMBL: ENSMUSP00000115373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473] [ENSMUST00000153432]
Predicted Effect probably benign
Transcript: ENSMUST00000119142
AA Change: S415G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: S415G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121473
AA Change: S415G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: S415G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126682
Predicted Effect probably benign
Transcript: ENSMUST00000153432
AA Change: S415G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000115373
Gene: ENSMUSG00000062209
AA Change: S415G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.7e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.7e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 649 2.98e0 SMART
PDB:2R4B|B 680 732 1e-25 PDB
Meta Mutation Damage Score 0.1360 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (106/108)
MGI Phenotype Strain: 1929607
Lethality: E10-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T C 3: 68,870,264 V186A possibly damaging Het
1700088E04Rik A T 15: 79,135,209 M198K probably damaging Het
4931406P16Rik T C 7: 34,238,908 probably benign Het
4933402J07Rik A G 8: 87,567,973 K84R probably null Het
9930021J03Rik G T 19: 29,717,216 L1626I possibly damaging Het
A530099J19Rik T A 13: 19,729,670 noncoding transcript Het
Aamdc T C 7: 97,550,566 probably null Het
Abcc9 A G 6: 142,671,556 V594A probably damaging Het
Adamts13 G A 2: 26,989,402 D656N probably benign Het
Adcy10 G T 1: 165,506,644 C122F probably damaging Het
Adi1 A G 12: 28,675,253 M1V probably null Het
Ahnak G A 19: 9,012,460 probably benign Het
Akt1 G T 12: 112,657,087 P313Q probably damaging Het
Ano3 A T 2: 110,667,722 M758K probably damaging Het
Baz2a T A 10: 128,123,130 N1168K probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bcap29 A G 12: 31,624,203 I131T probably benign Het
Btnl6 T C 17: 34,513,992 D299G possibly damaging Het
Ccdc66 A G 14: 27,500,567 I73T probably benign Het
Cdh2 A G 18: 16,627,697 S538P probably benign Het
Cfap54 T A 10: 92,967,528 M1551L probably benign Het
Chd2 G A 7: 73,502,125 A243V probably damaging Het
Cntnap1 T A 11: 101,183,019 N665K probably damaging Het
Colgalt2 C T 1: 152,484,998 T262I possibly damaging Het
Cyp24a1 T C 2: 170,496,178 I149V probably benign Het
Cyp2a5 T A 7: 26,835,545 probably null Het
Dab2 A G 15: 6,336,599 probably null Het
Dnah17 T A 11: 118,026,780 I4158F probably damaging Het
Dnm2 G A 9: 21,474,679 probably null Het
Dpp7 A T 2: 25,352,386 probably benign Het
Epha6 T A 16: 59,960,413 I642F probably damaging Het
Fancd2 A G 6: 113,553,722 T439A probably benign Het
Fat1 G A 8: 45,013,065 V1431M possibly damaging Het
Fhod3 G A 18: 25,090,248 A884T probably benign Het
Fsip2 A G 2: 82,990,171 D5416G possibly damaging Het
Gabarap C T 11: 69,991,852 probably benign Het
Gm11544 C T 11: 94,845,706 noncoding transcript Het
Gnat2 A C 3: 108,100,648 K304Q probably benign Het
Gramd4 C T 15: 86,134,856 A575V probably benign Het
Gtpbp10 G A 5: 5,539,295 A274V possibly damaging Het
Gzmb A G 14: 56,260,222 I187T probably damaging Het
H2-M10.2 G A 17: 36,284,327 T315I probably damaging Het
Haus5 A T 7: 30,657,027 F524I probably damaging Het
Herc1 A G 9: 66,495,971 S4391G probably benign Het
Herc2 T A 7: 56,098,417 L511* probably null Het
Htt T A 5: 34,824,840 C923S probably benign Het
Idua T C 5: 108,669,381 S7P probably benign Het
Ighv16-1 A T 12: 114,068,846 L112Q probably damaging Het
Igkv1-110 A G 6: 68,271,201 K98R probably benign Het
Kif15 G A 9: 123,002,126 probably null Het
Leng9 C A 7: 4,149,030 G216W probably damaging Het
Lrpprc A G 17: 84,707,156 L1306S probably benign Het
Lztfl1 C A 9: 123,715,389 E20D possibly damaging Het
Maob T C X: 16,716,423 T400A probably benign Het
Map3k4 C T 17: 12,271,780 E255K probably damaging Het
Megf9 G A 4: 70,534,428 T132M probably damaging Het
Mob4 T C 1: 55,145,252 probably benign Het
Mttp G A 3: 138,116,050 A252V probably benign Het
Mxi1 A G 19: 53,370,314 D226G probably damaging Het
Myh14 A G 7: 44,625,142 S1249P probably benign Het
Mylk G A 16: 34,922,367 G1083D probably benign Het
Mylk4 T G 13: 32,721,977 I408L probably benign Het
Nbas A G 12: 13,483,739 S1792G probably benign Het
Nelfb A G 2: 25,209,969 V212A probably damaging Het
Nisch T C 14: 31,177,630 probably benign Het
Nqo1 C G 8: 107,388,845 D267H probably benign Het
Olfr1037 C A 2: 86,084,846 L310F probably benign Het
Pcid2 T A 8: 13,085,425 I195F probably damaging Het
Pcnx2 A T 8: 125,752,188 M2107K probably damaging Het
Pgd A T 4: 149,156,591 probably benign Het
Prim2 T C 1: 33,464,064 M430V probably benign Het
Prkaa1 A G 15: 5,160,620 T40A probably damaging Het
Ptges T C 2: 30,903,220 probably benign Het
Ptprn T C 1: 75,258,265 E226G probably benign Het
Rab14 A G 2: 35,189,966 F55S probably damaging Het
Ralgps2 A T 1: 156,857,067 probably benign Het
Rgs11 C T 17: 26,207,568 H258Y probably benign Het
Rhpn2 T C 7: 35,376,349 probably null Het
Rprd2 A T 3: 95,774,171 V452E probably damaging Het
Scube3 C A 17: 28,166,015 H646Q probably damaging Het
Selp A T 1: 164,126,340 I70F probably damaging Het
Sept2 A G 1: 93,499,127 I153V probably damaging Het
Sh3rf3 G A 10: 58,814,083 S170N probably benign Het
Skint4 A T 4: 112,143,766 I353F possibly damaging Het
Slc16a12 A G 19: 34,680,380 I41T possibly damaging Het
Snai2 T C 16: 14,707,017 F129S probably damaging Het
Top3b C T 16: 16,890,662 R629* probably null Het
Trim17 T A 11: 58,971,444 V434E probably damaging Het
Ttn G A 2: 76,784,983 P15051L probably damaging Het
Uggt2 A T 14: 119,001,847 I1391N probably damaging Het
Usp8 A T 2: 126,755,038 M923L probably damaging Het
Vmn1r176 T C 7: 23,835,038 H230R possibly damaging Het
Vmn1r217 C A 13: 23,113,989 D248Y probably damaging Het
Vmn2r14 A T 5: 109,216,110 C647S probably damaging Het
Vwa5b1 A G 4: 138,605,540 I237T probably damaging Het
Zan T A 5: 137,393,161 D4687V unknown Het
Zfp273 T C 13: 67,825,365 V204A probably benign Het
Zfp956 T G 6: 47,952,053 probably benign Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68071630 nonsense probably null
IGL01020:Erbb4 APN 1 68298449 splice site probably benign
IGL01349:Erbb4 APN 1 68346593 missense probably benign 0.00
IGL01386:Erbb4 APN 1 68343931 missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68328245 nonsense probably null
IGL01536:Erbb4 APN 1 68290282 missense probably benign 0.00
IGL01721:Erbb4 APN 1 68254563 missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68254566 missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68080726 missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68042535 missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68290294 missense probably benign 0.00
IGL02399:Erbb4 APN 1 68042437 splice site probably benign
IGL02553:Erbb4 APN 1 68305864 missense probably benign 0.17
IGL03118:Erbb4 APN 1 68042719 missense probably benign 0.11
IGL03329:Erbb4 APN 1 68328122 missense probably benign 0.30
IGL03405:Erbb4 APN 1 68330238 missense probably benign 0.02
excrescence UTSW 1 68330246 missense probably damaging 1.00
Mole UTSW 1 68560576 missense probably damaging 1.00
tag UTSW 1 68250580 missense possibly damaging 0.67
P0018:Erbb4 UTSW 1 68071676 missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68075543 missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68043960 intron probably benign
R0329:Erbb4 UTSW 1 68298280 splice site probably benign
R0335:Erbb4 UTSW 1 68259259 missense probably benign
R0362:Erbb4 UTSW 1 68330270 missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68042462 missense probably benign 0.17
R0730:Erbb4 UTSW 1 68259290 missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68309614 missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68254600 missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68346546 missense probably benign 0.00
R1523:Erbb4 UTSW 1 68396252 missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68078582 nonsense probably null
R1604:Erbb4 UTSW 1 68346569 missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68040388 missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68331234 missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68075410 splice site probably benign
R1929:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68298323 missense probably benign 0.02
R2139:Erbb4 UTSW 1 68346629 missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68042531 missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68078596 missense probably benign 0.00
R3821:Erbb4 UTSW 1 68305913 missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68740401 missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68040337 missense probably benign 0.07
R4196:Erbb4 UTSW 1 68343855 missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68346622 missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68343921 nonsense probably null
R4642:Erbb4 UTSW 1 68250632 missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68298314 missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68254544 missense probably damaging 1.00
R5068:Erbb4 UTSW 1 68043902 splice site probably null
R5546:Erbb4 UTSW 1 68298293 missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68560519 missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68043916 missense probably benign
R6257:Erbb4 UTSW 1 68396273 missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68042530 missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68370503 missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68040303 missense probably benign 0.00
R7087:Erbb4 UTSW 1 68740491 missense probably null 1.00
R7215:Erbb4 UTSW 1 68339460 missense probably benign
R7356:Erbb4 UTSW 1 68339355 critical splice donor site probably null
R7509:Erbb4 UTSW 1 68250580 missense possibly damaging 0.67
R7593:Erbb4 UTSW 1 68254599 missense probably damaging 0.99
R7743:Erbb4 UTSW 1 68328119 missense probably benign 0.00
R7784:Erbb4 UTSW 1 68075499 missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68042726 missense probably damaging 1.00
X0019:Erbb4 UTSW 1 68073145 missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68298402 frame shift probably null
Z1176:Erbb4 UTSW 1 68328259 nonsense probably null
Z1177:Erbb4 UTSW 1 68259183 frame shift probably null
Z1177:Erbb4 UTSW 1 68290476 missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68309643 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTTCAGGAGGCTCATCTTCAG -3'
(R):5'- AAAACATGGATTCTTGGTGTCGC -3'

Sequencing Primer
(F):5'- GGAGGCTCATCTTCAGAATTAATCAG -3'
(R):5'- CTTGGTGTCGCTCTTTAATAATA -3'
Posted On2016-03-01