Incidental Mutation 'R4832:Adcy10'
ID372873
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Nameadenylate cyclase 10
SynonymssAC, Sacy, soluble adenylyl cyclase
MMRRC Submission 042448-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R4832 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location165485183-165576774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 165506644 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 122 (C122F)
Ref Sequence ENSEMBL: ENSMUSP00000137959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
Predicted Effect probably damaging
Transcript: ENSMUST00000027852
AA Change: C122F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: C122F

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111439
AA Change: C122F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: C122F

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111440
AA Change: C122F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: C122F

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000148550
AA Change: C122F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567
AA Change: C122F

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect unknown
Transcript: ENSMUST00000193149
AA Change: C74F
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195194
Meta Mutation Damage Score 0.4683 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (106/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T C 3: 68,870,264 V186A possibly damaging Het
1700088E04Rik A T 15: 79,135,209 M198K probably damaging Het
4931406P16Rik T C 7: 34,238,908 probably benign Het
4933402J07Rik A G 8: 87,567,973 K84R probably null Het
9930021J03Rik G T 19: 29,717,216 L1626I possibly damaging Het
A530099J19Rik T A 13: 19,729,670 noncoding transcript Het
Aamdc T C 7: 97,550,566 probably null Het
Abcc9 A G 6: 142,671,556 V594A probably damaging Het
Adamts13 G A 2: 26,989,402 D656N probably benign Het
Adi1 A G 12: 28,675,253 M1V probably null Het
Ahnak G A 19: 9,012,460 probably benign Het
Akt1 G T 12: 112,657,087 P313Q probably damaging Het
Ano3 A T 2: 110,667,722 M758K probably damaging Het
Baz2a T A 10: 128,123,130 N1168K probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bcap29 A G 12: 31,624,203 I131T probably benign Het
Btnl6 T C 17: 34,513,992 D299G possibly damaging Het
Ccdc66 A G 14: 27,500,567 I73T probably benign Het
Cdh2 A G 18: 16,627,697 S538P probably benign Het
Cfap54 T A 10: 92,967,528 M1551L probably benign Het
Chd2 G A 7: 73,502,125 A243V probably damaging Het
Cntnap1 T A 11: 101,183,019 N665K probably damaging Het
Colgalt2 C T 1: 152,484,998 T262I possibly damaging Het
Cyp24a1 T C 2: 170,496,178 I149V probably benign Het
Cyp2a5 T A 7: 26,835,545 probably null Het
Dab2 A G 15: 6,336,599 probably null Het
Dnah17 T A 11: 118,026,780 I4158F probably damaging Het
Dnm2 G A 9: 21,474,679 probably null Het
Dpp7 A T 2: 25,352,386 probably benign Het
Epha6 T A 16: 59,960,413 I642F probably damaging Het
Erbb4 T C 1: 68,330,238 S415G probably benign Het
Fancd2 A G 6: 113,553,722 T439A probably benign Het
Fat1 G A 8: 45,013,065 V1431M possibly damaging Het
Fhod3 G A 18: 25,090,248 A884T probably benign Het
Fsip2 A G 2: 82,990,171 D5416G possibly damaging Het
Gabarap C T 11: 69,991,852 probably benign Het
Gm11544 C T 11: 94,845,706 noncoding transcript Het
Gnat2 A C 3: 108,100,648 K304Q probably benign Het
Gramd4 C T 15: 86,134,856 A575V probably benign Het
Gtpbp10 G A 5: 5,539,295 A274V possibly damaging Het
Gzmb A G 14: 56,260,222 I187T probably damaging Het
H2-M10.2 G A 17: 36,284,327 T315I probably damaging Het
Haus5 A T 7: 30,657,027 F524I probably damaging Het
Herc1 A G 9: 66,495,971 S4391G probably benign Het
Herc2 T A 7: 56,098,417 L511* probably null Het
Htt T A 5: 34,824,840 C923S probably benign Het
Idua T C 5: 108,669,381 S7P probably benign Het
Ighv16-1 A T 12: 114,068,846 L112Q probably damaging Het
Igkv1-110 A G 6: 68,271,201 K98R probably benign Het
Kif15 G A 9: 123,002,126 probably null Het
Leng9 C A 7: 4,149,030 G216W probably damaging Het
Lrpprc A G 17: 84,707,156 L1306S probably benign Het
Lztfl1 C A 9: 123,715,389 E20D possibly damaging Het
Maob T C X: 16,716,423 T400A probably benign Het
Map3k4 C T 17: 12,271,780 E255K probably damaging Het
Megf9 G A 4: 70,534,428 T132M probably damaging Het
Mob4 T C 1: 55,145,252 probably benign Het
Mttp G A 3: 138,116,050 A252V probably benign Het
Mxi1 A G 19: 53,370,314 D226G probably damaging Het
Myh14 A G 7: 44,625,142 S1249P probably benign Het
Mylk G A 16: 34,922,367 G1083D probably benign Het
Mylk4 T G 13: 32,721,977 I408L probably benign Het
Nbas A G 12: 13,483,739 S1792G probably benign Het
Nelfb A G 2: 25,209,969 V212A probably damaging Het
Nisch T C 14: 31,177,630 probably benign Het
Nqo1 C G 8: 107,388,845 D267H probably benign Het
Olfr1037 C A 2: 86,084,846 L310F probably benign Het
Pcid2 T A 8: 13,085,425 I195F probably damaging Het
Pcnx2 A T 8: 125,752,188 M2107K probably damaging Het
Pgd A T 4: 149,156,591 probably benign Het
Prim2 T C 1: 33,464,064 M430V probably benign Het
Prkaa1 A G 15: 5,160,620 T40A probably damaging Het
Ptges T C 2: 30,903,220 probably benign Het
Ptprn T C 1: 75,258,265 E226G probably benign Het
Rab14 A G 2: 35,189,966 F55S probably damaging Het
Ralgps2 A T 1: 156,857,067 probably benign Het
Rgs11 C T 17: 26,207,568 H258Y probably benign Het
Rhpn2 T C 7: 35,376,349 probably null Het
Rprd2 A T 3: 95,774,171 V452E probably damaging Het
Scube3 C A 17: 28,166,015 H646Q probably damaging Het
Selp A T 1: 164,126,340 I70F probably damaging Het
Sept2 A G 1: 93,499,127 I153V probably damaging Het
Sh3rf3 G A 10: 58,814,083 S170N probably benign Het
Skint4 A T 4: 112,143,766 I353F possibly damaging Het
Slc16a12 A G 19: 34,680,380 I41T possibly damaging Het
Snai2 T C 16: 14,707,017 F129S probably damaging Het
Top3b C T 16: 16,890,662 R629* probably null Het
Trim17 T A 11: 58,971,444 V434E probably damaging Het
Ttn G A 2: 76,784,983 P15051L probably damaging Het
Uggt2 A T 14: 119,001,847 I1391N probably damaging Het
Usp8 A T 2: 126,755,038 M923L probably damaging Het
Vmn1r176 T C 7: 23,835,038 H230R possibly damaging Het
Vmn1r217 C A 13: 23,113,989 D248Y probably damaging Het
Vmn2r14 A T 5: 109,216,110 C647S probably damaging Het
Vwa5b1 A G 4: 138,605,540 I237T probably damaging Het
Zan T A 5: 137,393,161 D4687V unknown Het
Zfp273 T C 13: 67,825,365 V204A probably benign Het
Zfp956 T G 6: 47,952,053 probably benign Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165551914 missense probably benign 0.45
IGL00731:Adcy10 APN 1 165572614 missense probably benign
IGL01099:Adcy10 APN 1 165539842 missense probably benign 0.21
IGL01464:Adcy10 APN 1 165546587 missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165513168 critical splice donor site probably null
IGL02002:Adcy10 APN 1 165521843 missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165570620 missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165572543 missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165559128 missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165538380 missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165510408 missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165570744 missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165567726 missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165543233 missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165519518 missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165538475 nonsense probably null
PIT4514001:Adcy10 UTSW 1 165556791 missense probably benign 0.28
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165572591 missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165564249 missense probably benign 0.00
R0433:Adcy10 UTSW 1 165552022 missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165570728 missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165510390 missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165519519 missense probably benign 0.04
R0533:Adcy10 UTSW 1 165564023 missense probably benign 0.05
R0550:Adcy10 UTSW 1 165565315 missense probably benign 0.00
R0554:Adcy10 UTSW 1 165513130 missense probably benign
R0597:Adcy10 UTSW 1 165525062 critical splice donor site probably null
R0629:Adcy10 UTSW 1 165543105 missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165563947 missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165515380 missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165518403 missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165518312 missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165525033 missense probably benign 0.02
R1690:Adcy10 UTSW 1 165519925 missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165503243 missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165521961 missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165570808 missense probably benign 0.02
R1929:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165525022 missense probably benign 0.02
R2211:Adcy10 UTSW 1 165518212 missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165558597 missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165575727 missense probably benign 0.38
R4538:Adcy10 UTSW 1 165513127 missense probably benign 0.38
R4644:Adcy10 UTSW 1 165551361 critical splice donor site probably null
R4649:Adcy10 UTSW 1 165504049 missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165548213 missense probably benign
R4916:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165563963 missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165556862 missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165519500 missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165519895 missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165513140 missense probably benign 0.43
R5692:Adcy10 UTSW 1 165515306 missense probably benign 0.36
R5949:Adcy10 UTSW 1 165539817 missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165541649 missense probably benign 0.19
R6238:Adcy10 UTSW 1 165575728 nonsense probably null
R6455:Adcy10 UTSW 1 165518374 missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165575658 missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165506635 missense probably benign 0.21
R6957:Adcy10 UTSW 1 165564285 missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165556916 missense probably benign 0.02
R7027:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165539874 missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165538522 missense probably benign 0.27
R7130:Adcy10 UTSW 1 165504047 missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165510370 missense probably benign 0.01
R7182:Adcy10 UTSW 1 165543470 intron probably null
R7228:Adcy10 UTSW 1 165510272 missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165576608 missense unknown
R7561:Adcy10 UTSW 1 165559172 missense possibly damaging 0.94
R7603:Adcy10 UTSW 1 165564237 missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165570771 missense probably benign 0.01
R7812:Adcy10 UTSW 1 165515369 missense probably damaging 1.00
R7905:Adcy10 UTSW 1 165513168 critical splice donor site probably null
R7988:Adcy10 UTSW 1 165513168 critical splice donor site probably null
R8040:Adcy10 UTSW 1 165552024 missense probably damaging 1.00
RF018:Adcy10 UTSW 1 165552109 missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165510276 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GTTGAGAAATGTTTGAAGCAGCAC -3'
(R):5'- CCCCAACTACTGTAGCATCTG -3'

Sequencing Primer
(F):5'- CAAGCTTGTGCAATGTTCATGC -3'
(R):5'- GAGACTGTCTCGTTATGTCACC -3'
Posted On2016-03-01