Incidental Mutation 'R4832:Olfr1037'
ID372881
Institutional Source Beutler Lab
Gene Symbol Olfr1037
Ensembl Gene ENSMUSG00000075205
Gene Nameolfactory receptor 1037
SynonymsMOR171-52, MOR256-34P, GA_x6K02T2Q125-47560740-47559775
MMRRC Submission 042448-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4832 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86084671-86087385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 86084846 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 310 (L310F)
Ref Sequence ENSEMBL: ENSMUSP00000150319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099911] [ENSMUST00000213333] [ENSMUST00000216020] [ENSMUST00000216886]
Predicted Effect probably benign
Transcript: ENSMUST00000099911
AA Change: L310F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097495
Gene: ENSMUSG00000075205
AA Change: L310F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-54 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213333
AA Change: L310F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216020
AA Change: L310F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216886
AA Change: L310F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (106/108)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T C 3: 68,870,264 V186A possibly damaging Het
1700088E04Rik A T 15: 79,135,209 M198K probably damaging Het
4931406P16Rik T C 7: 34,238,908 probably benign Het
4933402J07Rik A G 8: 87,567,973 K84R probably null Het
9930021J03Rik G T 19: 29,717,216 L1626I possibly damaging Het
A530099J19Rik T A 13: 19,729,670 noncoding transcript Het
Aamdc T C 7: 97,550,566 probably null Het
Abcc9 A G 6: 142,671,556 V594A probably damaging Het
Adamts13 G A 2: 26,989,402 D656N probably benign Het
Adcy10 G T 1: 165,506,644 C122F probably damaging Het
Adi1 A G 12: 28,675,253 M1V probably null Het
Ahnak G A 19: 9,012,460 probably benign Het
Akt1 G T 12: 112,657,087 P313Q probably damaging Het
Ano3 A T 2: 110,667,722 M758K probably damaging Het
Baz2a T A 10: 128,123,130 N1168K probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bcap29 A G 12: 31,624,203 I131T probably benign Het
Btnl6 T C 17: 34,513,992 D299G possibly damaging Het
Ccdc66 A G 14: 27,500,567 I73T probably benign Het
Cdh2 A G 18: 16,627,697 S538P probably benign Het
Cfap54 T A 10: 92,967,528 M1551L probably benign Het
Chd2 G A 7: 73,502,125 A243V probably damaging Het
Cntnap1 T A 11: 101,183,019 N665K probably damaging Het
Colgalt2 C T 1: 152,484,998 T262I possibly damaging Het
Cyp24a1 T C 2: 170,496,178 I149V probably benign Het
Cyp2a5 T A 7: 26,835,545 probably null Het
Dab2 A G 15: 6,336,599 probably null Het
Dnah17 T A 11: 118,026,780 I4158F probably damaging Het
Dnm2 G A 9: 21,474,679 probably null Het
Dpp7 A T 2: 25,352,386 probably benign Het
Epha6 T A 16: 59,960,413 I642F probably damaging Het
Erbb4 T C 1: 68,330,238 S415G probably benign Het
Fancd2 A G 6: 113,553,722 T439A probably benign Het
Fat1 G A 8: 45,013,065 V1431M possibly damaging Het
Fhod3 G A 18: 25,090,248 A884T probably benign Het
Fsip2 A G 2: 82,990,171 D5416G possibly damaging Het
Gabarap C T 11: 69,991,852 probably benign Het
Gm11544 C T 11: 94,845,706 noncoding transcript Het
Gnat2 A C 3: 108,100,648 K304Q probably benign Het
Gramd4 C T 15: 86,134,856 A575V probably benign Het
Gtpbp10 G A 5: 5,539,295 A274V possibly damaging Het
Gzmb A G 14: 56,260,222 I187T probably damaging Het
H2-M10.2 G A 17: 36,284,327 T315I probably damaging Het
Haus5 A T 7: 30,657,027 F524I probably damaging Het
Herc1 A G 9: 66,495,971 S4391G probably benign Het
Herc2 T A 7: 56,098,417 L511* probably null Het
Htt T A 5: 34,824,840 C923S probably benign Het
Idua T C 5: 108,669,381 S7P probably benign Het
Ighv16-1 A T 12: 114,068,846 L112Q probably damaging Het
Igkv1-110 A G 6: 68,271,201 K98R probably benign Het
Kif15 G A 9: 123,002,126 probably null Het
Leng9 C A 7: 4,149,030 G216W probably damaging Het
Lrpprc A G 17: 84,707,156 L1306S probably benign Het
Lztfl1 C A 9: 123,715,389 E20D possibly damaging Het
Maob T C X: 16,716,423 T400A probably benign Het
Map3k4 C T 17: 12,271,780 E255K probably damaging Het
Megf9 G A 4: 70,534,428 T132M probably damaging Het
Mob4 T C 1: 55,145,252 probably benign Het
Mttp G A 3: 138,116,050 A252V probably benign Het
Mxi1 A G 19: 53,370,314 D226G probably damaging Het
Myh14 A G 7: 44,625,142 S1249P probably benign Het
Mylk G A 16: 34,922,367 G1083D probably benign Het
Mylk4 T G 13: 32,721,977 I408L probably benign Het
Nbas A G 12: 13,483,739 S1792G probably benign Het
Nelfb A G 2: 25,209,969 V212A probably damaging Het
Nisch T C 14: 31,177,630 probably benign Het
Nqo1 C G 8: 107,388,845 D267H probably benign Het
Pcid2 T A 8: 13,085,425 I195F probably damaging Het
Pcnx2 A T 8: 125,752,188 M2107K probably damaging Het
Pgd A T 4: 149,156,591 probably benign Het
Prim2 T C 1: 33,464,064 M430V probably benign Het
Prkaa1 A G 15: 5,160,620 T40A probably damaging Het
Ptges T C 2: 30,903,220 probably benign Het
Ptprn T C 1: 75,258,265 E226G probably benign Het
Rab14 A G 2: 35,189,966 F55S probably damaging Het
Ralgps2 A T 1: 156,857,067 probably benign Het
Rgs11 C T 17: 26,207,568 H258Y probably benign Het
Rhpn2 T C 7: 35,376,349 probably null Het
Rprd2 A T 3: 95,774,171 V452E probably damaging Het
Scube3 C A 17: 28,166,015 H646Q probably damaging Het
Selp A T 1: 164,126,340 I70F probably damaging Het
Sept2 A G 1: 93,499,127 I153V probably damaging Het
Sh3rf3 G A 10: 58,814,083 S170N probably benign Het
Skint4 A T 4: 112,143,766 I353F possibly damaging Het
Slc16a12 A G 19: 34,680,380 I41T possibly damaging Het
Snai2 T C 16: 14,707,017 F129S probably damaging Het
Top3b C T 16: 16,890,662 R629* probably null Het
Trim17 T A 11: 58,971,444 V434E probably damaging Het
Ttn G A 2: 76,784,983 P15051L probably damaging Het
Uggt2 A T 14: 119,001,847 I1391N probably damaging Het
Usp8 A T 2: 126,755,038 M923L probably damaging Het
Vmn1r176 T C 7: 23,835,038 H230R possibly damaging Het
Vmn1r217 C A 13: 23,113,989 D248Y probably damaging Het
Vmn2r14 A T 5: 109,216,110 C647S probably damaging Het
Vwa5b1 A G 4: 138,605,540 I237T probably damaging Het
Zan T A 5: 137,393,161 D4687V unknown Het
Zfp273 T C 13: 67,825,365 V204A probably benign Het
Zfp956 T G 6: 47,952,053 probably benign Het
Other mutations in Olfr1037
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Olfr1037 APN 2 86085640 missense probably benign 0.05
IGL02534:Olfr1037 APN 2 86085369 missense probably damaging 1.00
IGL03204:Olfr1037 APN 2 86085671 nonsense probably null
R0054:Olfr1037 UTSW 2 86085361 missense probably benign 0.38
R0054:Olfr1037 UTSW 2 86085361 missense probably benign 0.38
R0131:Olfr1037 UTSW 2 86085500 missense probably damaging 1.00
R0131:Olfr1037 UTSW 2 86085500 missense probably damaging 1.00
R0666:Olfr1037 UTSW 2 86085213 missense probably benign 0.03
R0732:Olfr1037 UTSW 2 86085584 missense probably benign 0.00
R1167:Olfr1037 UTSW 2 86085291 missense probably benign 0.16
R1899:Olfr1037 UTSW 2 86085720 missense probably benign
R3082:Olfr1037 UTSW 2 86085709 missense probably benign
R3847:Olfr1037 UTSW 2 86085407 nonsense probably null
R3848:Olfr1037 UTSW 2 86085407 nonsense probably null
R4079:Olfr1037 UTSW 2 86085312 missense possibly damaging 0.67
R4193:Olfr1037 UTSW 2 86085700 missense probably benign 0.01
R5244:Olfr1037 UTSW 2 86084956 missense probably damaging 1.00
R5643:Olfr1037 UTSW 2 86085159 missense probably damaging 0.98
R5644:Olfr1037 UTSW 2 86085159 missense probably damaging 0.98
R5974:Olfr1037 UTSW 2 86084881 missense probably benign
R6136:Olfr1037 UTSW 2 86084901 missense probably damaging 1.00
R6189:Olfr1037 UTSW 2 86084913 missense possibly damaging 0.53
R6483:Olfr1037 UTSW 2 86085440 missense probably benign 0.00
R6569:Olfr1037 UTSW 2 86085505 missense possibly damaging 0.87
R6724:Olfr1037 UTSW 2 86085357 missense possibly damaging 0.81
R6867:Olfr1037 UTSW 2 86085738 missense possibly damaging 0.59
R7081:Olfr1037 UTSW 2 86085595 missense probably damaging 1.00
R7207:Olfr1037 UTSW 2 86084815 missense possibly damaging 0.93
R7436:Olfr1037 UTSW 2 86084907 missense probably damaging 1.00
X0062:Olfr1037 UTSW 2 86085114 missense probably damaging 1.00
Z1088:Olfr1037 UTSW 2 86084982 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTCATAAAATCAGGCTTGTATGG -3'
(R):5'- TCCCATCTGACTGCTGTGAC -3'

Sequencing Primer
(F):5'- CAGGCTTGTATGGTGTTTTATTCAC -3'
(R):5'- ACTGCTGTGACTATATTCTATGGGAC -3'
Posted On2016-03-01