Incidental Mutation 'R4832:Idua'
ID372894
Institutional Source Beutler Lab
Gene Symbol Idua
Ensembl Gene ENSMUSG00000033540
Gene Nameiduronidase, alpha-L-
Synonyms
MMRRC Submission 042448-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R4832 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location108660331-108684557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108669381 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 7 (S7P)
Ref Sequence ENSEMBL: ENSMUSP00000119624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051757] [ENSMUST00000071650] [ENSMUST00000112563] [ENSMUST00000119212] [ENSMUST00000119270] [ENSMUST00000132708] [ENSMUST00000136227] [ENSMUST00000139734] [ENSMUST00000140620] [ENSMUST00000163328]
Predicted Effect probably benign
Transcript: ENSMUST00000051757
SMART Domains Protein: ENSMUSP00000051561
Gene: ENSMUSG00000046959

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.9e-31 PFAM
Pfam:Sulfate_transp 200 478 3.1e-84 PFAM
Pfam:STAS 536 686 9.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071650
AA Change: S7P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071577
Gene: ENSMUSG00000033540
AA Change: S7P

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 1.4e-223 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112563
AA Change: S7P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108182
Gene: ENSMUSG00000033540
AA Change: S7P

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 2.1e-224 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119212
AA Change: S7P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113190
Gene: ENSMUSG00000033540
AA Change: S7P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Glyco_hydro_39 48 495 2.4e-193 PFAM
SCOP:d1bpv__ 499 596 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119270
SMART Domains Protein: ENSMUSP00000113185
Gene: ENSMUSG00000046959

DomainStartEndE-ValueType
Pfam:Sulfate_transp 85 498 7.3e-135 PFAM
Pfam:STAS 552 702 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132708
SMART Domains Protein: ENSMUSP00000122837
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
Blast:C1 26 56 2e-13 BLAST
low complexity region 68 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136227
SMART Domains Protein: ENSMUSP00000116540
Gene: ENSMUSG00000046959

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 3.4e-31 PFAM
Pfam:Sulfate_transp 200 416 2.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139734
AA Change: S7P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117694
Gene: ENSMUSG00000033540
AA Change: S7P

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 199 6.8e-80 PFAM
low complexity region 235 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140620
AA Change: S7P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119624
Gene: ENSMUSG00000033540
AA Change: S7P

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 150 3.4e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159464
Predicted Effect probably benign
Transcript: ENSMUST00000163328
SMART Domains Protein: ENSMUSP00000131282
Gene: ENSMUSG00000046959

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.9e-31 PFAM
Pfam:Sulfate_transp 200 478 3.1e-84 PFAM
Pfam:STAS 536 686 9.5e-29 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (106/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes the terminal alpha-L-iduronic acid residues of two glycosaminoglycans, dermatan sulfate and heparan sulfate. This hydrolysis is required for the lysosomal degradation of these glycosaminoglycans. Mutations in this gene that result in enzymatic deficiency lead to the autosomal recessive disease mucopolysaccharidosis type I (MPS I). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutants show lysosomal storage in multiple tissues, increased urinary GAG, craniofacial and skeletal defects, increased body weight, impaired habituation and long-term memory for aversive training, reduced ventricular function with valve insufficiency, and progressive hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T C 3: 68,870,264 V186A possibly damaging Het
1700088E04Rik A T 15: 79,135,209 M198K probably damaging Het
4931406P16Rik T C 7: 34,238,908 probably benign Het
4933402J07Rik A G 8: 87,567,973 K84R probably null Het
9930021J03Rik G T 19: 29,717,216 L1626I possibly damaging Het
A530099J19Rik T A 13: 19,729,670 noncoding transcript Het
Aamdc T C 7: 97,550,566 probably null Het
Abcc9 A G 6: 142,671,556 V594A probably damaging Het
Adamts13 G A 2: 26,989,402 D656N probably benign Het
Adcy10 G T 1: 165,506,644 C122F probably damaging Het
Adi1 A G 12: 28,675,253 M1V probably null Het
Ahnak G A 19: 9,012,460 probably benign Het
Akt1 G T 12: 112,657,087 P313Q probably damaging Het
Ano3 A T 2: 110,667,722 M758K probably damaging Het
Baz2a T A 10: 128,123,130 N1168K probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bcap29 A G 12: 31,624,203 I131T probably benign Het
Btnl6 T C 17: 34,513,992 D299G possibly damaging Het
Ccdc66 A G 14: 27,500,567 I73T probably benign Het
Cdh2 A G 18: 16,627,697 S538P probably benign Het
Cfap54 T A 10: 92,967,528 M1551L probably benign Het
Chd2 G A 7: 73,502,125 A243V probably damaging Het
Cntnap1 T A 11: 101,183,019 N665K probably damaging Het
Colgalt2 C T 1: 152,484,998 T262I possibly damaging Het
Cyp24a1 T C 2: 170,496,178 I149V probably benign Het
Cyp2a5 T A 7: 26,835,545 probably null Het
Dab2 A G 15: 6,336,599 probably null Het
Dnah17 T A 11: 118,026,780 I4158F probably damaging Het
Dnm2 G A 9: 21,474,679 probably null Het
Dpp7 A T 2: 25,352,386 probably benign Het
Epha6 T A 16: 59,960,413 I642F probably damaging Het
Erbb4 T C 1: 68,330,238 S415G probably benign Het
Fancd2 A G 6: 113,553,722 T439A probably benign Het
Fat1 G A 8: 45,013,065 V1431M possibly damaging Het
Fhod3 G A 18: 25,090,248 A884T probably benign Het
Fsip2 A G 2: 82,990,171 D5416G possibly damaging Het
Gabarap C T 11: 69,991,852 probably benign Het
Gm11544 C T 11: 94,845,706 noncoding transcript Het
Gnat2 A C 3: 108,100,648 K304Q probably benign Het
Gramd4 C T 15: 86,134,856 A575V probably benign Het
Gtpbp10 G A 5: 5,539,295 A274V possibly damaging Het
Gzmb A G 14: 56,260,222 I187T probably damaging Het
H2-M10.2 G A 17: 36,284,327 T315I probably damaging Het
Haus5 A T 7: 30,657,027 F524I probably damaging Het
Herc1 A G 9: 66,495,971 S4391G probably benign Het
Herc2 T A 7: 56,098,417 L511* probably null Het
Htt T A 5: 34,824,840 C923S probably benign Het
Ighv16-1 A T 12: 114,068,846 L112Q probably damaging Het
Igkv1-110 A G 6: 68,271,201 K98R probably benign Het
Kif15 G A 9: 123,002,126 probably null Het
Leng9 C A 7: 4,149,030 G216W probably damaging Het
Lrpprc A G 17: 84,707,156 L1306S probably benign Het
Lztfl1 C A 9: 123,715,389 E20D possibly damaging Het
Maob T C X: 16,716,423 T400A probably benign Het
Map3k4 C T 17: 12,271,780 E255K probably damaging Het
Megf9 G A 4: 70,534,428 T132M probably damaging Het
Mob4 T C 1: 55,145,252 probably benign Het
Mttp G A 3: 138,116,050 A252V probably benign Het
Mxi1 A G 19: 53,370,314 D226G probably damaging Het
Myh14 A G 7: 44,625,142 S1249P probably benign Het
Mylk G A 16: 34,922,367 G1083D probably benign Het
Mylk4 T G 13: 32,721,977 I408L probably benign Het
Nbas A G 12: 13,483,739 S1792G probably benign Het
Nelfb A G 2: 25,209,969 V212A probably damaging Het
Nisch T C 14: 31,177,630 probably benign Het
Nqo1 C G 8: 107,388,845 D267H probably benign Het
Olfr1037 C A 2: 86,084,846 L310F probably benign Het
Pcid2 T A 8: 13,085,425 I195F probably damaging Het
Pcnx2 A T 8: 125,752,188 M2107K probably damaging Het
Pgd A T 4: 149,156,591 probably benign Het
Prim2 T C 1: 33,464,064 M430V probably benign Het
Prkaa1 A G 15: 5,160,620 T40A probably damaging Het
Ptges T C 2: 30,903,220 probably benign Het
Ptprn T C 1: 75,258,265 E226G probably benign Het
Rab14 A G 2: 35,189,966 F55S probably damaging Het
Ralgps2 A T 1: 156,857,067 probably benign Het
Rgs11 C T 17: 26,207,568 H258Y probably benign Het
Rhpn2 T C 7: 35,376,349 probably null Het
Rprd2 A T 3: 95,774,171 V452E probably damaging Het
Scube3 C A 17: 28,166,015 H646Q probably damaging Het
Selp A T 1: 164,126,340 I70F probably damaging Het
Sept2 A G 1: 93,499,127 I153V probably damaging Het
Sh3rf3 G A 10: 58,814,083 S170N probably benign Het
Skint4 A T 4: 112,143,766 I353F possibly damaging Het
Slc16a12 A G 19: 34,680,380 I41T possibly damaging Het
Snai2 T C 16: 14,707,017 F129S probably damaging Het
Top3b C T 16: 16,890,662 R629* probably null Het
Trim17 T A 11: 58,971,444 V434E probably damaging Het
Ttn G A 2: 76,784,983 P15051L probably damaging Het
Uggt2 A T 14: 119,001,847 I1391N probably damaging Het
Usp8 A T 2: 126,755,038 M923L probably damaging Het
Vmn1r176 T C 7: 23,835,038 H230R possibly damaging Het
Vmn1r217 C A 13: 23,113,989 D248Y probably damaging Het
Vmn2r14 A T 5: 109,216,110 C647S probably damaging Het
Vwa5b1 A G 4: 138,605,540 I237T probably damaging Het
Zan T A 5: 137,393,161 D4687V unknown Het
Zfp273 T C 13: 67,825,365 V204A probably benign Het
Zfp956 T G 6: 47,952,053 probably benign Het
Other mutations in Idua
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Idua APN 5 108680871 missense probably benign 0.34
IGL01575:Idua APN 5 108682107 missense possibly damaging 0.71
IGL02402:Idua APN 5 108679791 missense probably damaging 1.00
IGL03145:Idua APN 5 108681496 missense probably benign
cooper UTSW 5 108680314 missense probably damaging 1.00
R0208:Idua UTSW 5 108681752 missense probably damaging 1.00
R1572:Idua UTSW 5 108680589 missense probably benign
R1731:Idua UTSW 5 108681672 missense probably benign 0.00
R2024:Idua UTSW 5 108680734 missense probably damaging 1.00
R2126:Idua UTSW 5 108681438 missense possibly damaging 0.93
R3760:Idua UTSW 5 108670112 unclassified probably benign
R4747:Idua UTSW 5 108681036 missense probably damaging 0.97
R5140:Idua UTSW 5 108680314 missense probably damaging 1.00
R5543:Idua UTSW 5 108670229 missense probably benign 0.22
R5643:Idua UTSW 5 108680224 utr 3 prime probably benign
R5821:Idua UTSW 5 108679734 missense probably benign 0.29
R6004:Idua UTSW 5 108680644 missense probably benign
R6330:Idua UTSW 5 108681708 missense probably benign 0.21
R6963:Idua UTSW 5 108679775 missense possibly damaging 0.84
R7180:Idua UTSW 5 108680895 missense probably benign 0.43
R7453:Idua UTSW 5 108681496 missense probably benign
R7575:Idua UTSW 5 108681699 missense probably damaging 1.00
R7712:Idua UTSW 5 108681522 missense probably benign 0.10
R8026:Idua UTSW 5 108670249 missense probably benign 0.01
R8029:Idua UTSW 5 108669412 missense probably benign 0.23
R8074:Idua UTSW 5 108680575 missense possibly damaging 0.65
Z1177:Idua UTSW 5 108679584 missense probably null 0.80
Z1177:Idua UTSW 5 108680623 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATAATGGCCGCTCTGAGACAC -3'
(R):5'- CGCTCCTGGACTTGATAAGTGG -3'

Sequencing Primer
(F):5'- CCAAGCACTGCTAATGTTGG -3'
(R):5'- ACTTGATAAGTGGTGGGCCTCAC -3'
Posted On2016-03-01