Incidental Mutation 'R4832:Herc1'
ID 372914
Institutional Source Beutler Lab
Gene Symbol Herc1
Ensembl Gene ENSMUSG00000038664
Gene Name HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms tbl, D130015N03Rik, 2810449H11Rik
MMRRC Submission 042448-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4832 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 66257732-66416057 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 66403253 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 4391 (S4391G)
Ref Sequence ENSEMBL: ENSMUSP00000044801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042824]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000042824
AA Change: S4391G

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000044801
Gene: ENSMUSG00000038664
AA Change: S4391G

DomainStartEndE-ValueType
low complexity region 79 90 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
Pfam:RCC1 476 526 5.4e-15 PFAM
Pfam:RCC1_2 513 542 1.3e-9 PFAM
Pfam:RCC1 529 576 5.5e-16 PFAM
Pfam:RCC1 579 629 1.5e-10 PFAM
Pfam:RCC1 632 680 3.6e-9 PFAM
Pfam:RCC1_2 667 696 2.2e-11 PFAM
Pfam:RCC1 683 733 1.2e-14 PFAM
low complexity region 787 807 N/A INTRINSIC
low complexity region 852 864 N/A INTRINSIC
low complexity region 1014 1025 N/A INTRINSIC
low complexity region 1080 1100 N/A INTRINSIC
low complexity region 1348 1378 N/A INTRINSIC
low complexity region 1659 1676 N/A INTRINSIC
low complexity region 1865 1874 N/A INTRINSIC
low complexity region 2002 2030 N/A INTRINSIC
SPRY 2067 2188 1.8e-30 SMART
coiled coil region 2251 2280 N/A INTRINSIC
low complexity region 2410 2423 N/A INTRINSIC
low complexity region 2613 2629 N/A INTRINSIC
low complexity region 2633 2648 N/A INTRINSIC
low complexity region 2650 2667 N/A INTRINSIC
low complexity region 2736 2749 N/A INTRINSIC
low complexity region 2882 2896 N/A INTRINSIC
low complexity region 2924 2935 N/A INTRINSIC
low complexity region 2971 2987 N/A INTRINSIC
low complexity region 3045 3051 N/A INTRINSIC
low complexity region 3168 3186 N/A INTRINSIC
low complexity region 3191 3213 N/A INTRINSIC
low complexity region 3364 3379 N/A INTRINSIC
WD40 3415 3454 1.68e-6 SMART
WD40 3570 3608 3.68e1 SMART
WD40 3613 3652 4.3e-1 SMART
WD40 3657 3702 3.17e-2 SMART
WD40 3734 3773 8.29e-6 SMART
low complexity region 3950 3964 N/A INTRINSIC
Pfam:RCC1_2 4079 4111 7.3e-9 PFAM
Pfam:RCC1 4098 4147 3.4e-16 PFAM
Pfam:RCC1_2 4134 4163 1.8e-7 PFAM
Pfam:RCC1 4150 4199 7.2e-16 PFAM
Pfam:RCC1 4204 4252 6.1e-12 PFAM
Pfam:RCC1 4255 4304 2.4e-7 PFAM
Pfam:RCC1_2 4291 4320 5.8e-12 PFAM
Pfam:RCC1 4307 4356 8.9e-16 PFAM
Blast:HECTc 4389 4423 2e-11 BLAST
HECTc 4497 4846 8.2e-148 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135600
Meta Mutation Damage Score 0.1920 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (106/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gen encodes a member of the HERC protein family. This protein stimulates guanine nucleotide exchange on ARF1 and Rab proteins. This protein may be involved in membrane transport processes. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for this spontaneous mutation exhibit an abnormal cerebellar Purkinje cell layer and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T C 3: 68,777,597 (GRCm39) V186A possibly damaging Het
1700088E04Rik A T 15: 79,019,409 (GRCm39) M198K probably damaging Het
4933402J07Rik A G 8: 88,294,601 (GRCm39) K84R probably null Het
Aamdc T C 7: 97,199,773 (GRCm39) probably null Het
Abcc9 A G 6: 142,617,282 (GRCm39) V594A probably damaging Het
Adamts13 G A 2: 26,879,414 (GRCm39) D656N probably benign Het
Adcy10 G T 1: 165,334,213 (GRCm39) C122F probably damaging Het
Adi1 A G 12: 28,725,252 (GRCm39) M1V probably null Het
Ahnak G A 19: 8,989,824 (GRCm39) probably benign Het
Akt1 G T 12: 112,623,521 (GRCm39) P313Q probably damaging Het
Ano3 A T 2: 110,498,067 (GRCm39) M758K probably damaging Het
Baz2a T A 10: 127,958,999 (GRCm39) N1168K probably benign Het
Bbs10 A G 10: 111,136,995 (GRCm39) K703E probably benign Het
Bcap29 A G 12: 31,674,202 (GRCm39) I131T probably benign Het
Brd10 G T 19: 29,694,616 (GRCm39) L1626I possibly damaging Het
Btnl6 T C 17: 34,732,966 (GRCm39) D299G possibly damaging Het
Ccdc66 A G 14: 27,222,524 (GRCm39) I73T probably benign Het
Cdh2 A G 18: 16,760,754 (GRCm39) S538P probably benign Het
Cfap54 T A 10: 92,803,390 (GRCm39) M1551L probably benign Het
Chd2 G A 7: 73,151,873 (GRCm39) A243V probably damaging Het
Cntnap1 T A 11: 101,073,845 (GRCm39) N665K probably damaging Het
Colgalt2 C T 1: 152,360,749 (GRCm39) T262I possibly damaging Het
Cyp24a1 T C 2: 170,338,098 (GRCm39) I149V probably benign Het
Cyp2a5 T A 7: 26,534,970 (GRCm39) probably null Het
Dab2 A G 15: 6,366,080 (GRCm39) probably null Het
Dnah17 T A 11: 117,917,606 (GRCm39) I4158F probably damaging Het
Dnm2 G A 9: 21,385,975 (GRCm39) probably null Het
Dpp7 A T 2: 25,242,398 (GRCm39) probably benign Het
Epha6 T A 16: 59,780,776 (GRCm39) I642F probably damaging Het
Erbb4 T C 1: 68,369,397 (GRCm39) S415G probably benign Het
Fancd2 A G 6: 113,530,683 (GRCm39) T439A probably benign Het
Fat1 G A 8: 45,466,102 (GRCm39) V1431M possibly damaging Het
Fhod3 G A 18: 25,223,305 (GRCm39) A884T probably benign Het
Fsip2 A G 2: 82,820,515 (GRCm39) D5416G possibly damaging Het
Gabarap C T 11: 69,882,678 (GRCm39) probably benign Het
Garre1 T C 7: 33,938,333 (GRCm39) probably benign Het
Gm11544 C T 11: 94,736,532 (GRCm39) noncoding transcript Het
Gnat2 A C 3: 108,007,964 (GRCm39) K304Q probably benign Het
Gpr141b T A 13: 19,913,840 (GRCm39) noncoding transcript Het
Gramd4 C T 15: 86,019,057 (GRCm39) A575V probably benign Het
Gtpbp10 G A 5: 5,589,295 (GRCm39) A274V possibly damaging Het
Gzmb A G 14: 56,497,679 (GRCm39) I187T probably damaging Het
H2-M10.2 G A 17: 36,595,219 (GRCm39) T315I probably damaging Het
Haus5 A T 7: 30,356,452 (GRCm39) F524I probably damaging Het
Herc2 T A 7: 55,748,165 (GRCm39) L511* probably null Het
Htt T A 5: 34,982,184 (GRCm39) C923S probably benign Het
Idua T C 5: 108,817,247 (GRCm39) S7P probably benign Het
Ighv16-1 A T 12: 114,032,466 (GRCm39) L112Q probably damaging Het
Igkv1-110 A G 6: 68,248,185 (GRCm39) K98R probably benign Het
Kif15 G A 9: 122,831,191 (GRCm39) probably null Het
Leng9 C A 7: 4,152,029 (GRCm39) G216W probably damaging Het
Lrpprc A G 17: 85,014,584 (GRCm39) L1306S probably benign Het
Lztfl1 C A 9: 123,544,454 (GRCm39) E20D possibly damaging Het
Maob T C X: 16,582,662 (GRCm39) T400A probably benign Het
Map3k4 C T 17: 12,490,667 (GRCm39) E255K probably damaging Het
Megf9 G A 4: 70,452,665 (GRCm39) T132M probably damaging Het
Mob4 T C 1: 55,184,411 (GRCm39) probably benign Het
Mttp G A 3: 137,821,811 (GRCm39) A252V probably benign Het
Mxi1 A G 19: 53,358,745 (GRCm39) D226G probably damaging Het
Myh14 A G 7: 44,274,566 (GRCm39) S1249P probably benign Het
Mylk G A 16: 34,742,737 (GRCm39) G1083D probably benign Het
Mylk4 T G 13: 32,905,960 (GRCm39) I408L probably benign Het
Nbas A G 12: 13,533,740 (GRCm39) S1792G probably benign Het
Nelfb A G 2: 25,099,981 (GRCm39) V212A probably damaging Het
Nisch T C 14: 30,899,587 (GRCm39) probably benign Het
Nqo1 C G 8: 108,115,477 (GRCm39) D267H probably benign Het
Or8u10 C A 2: 85,915,190 (GRCm39) L310F probably benign Het
Pcid2 T A 8: 13,135,425 (GRCm39) I195F probably damaging Het
Pcnx2 A T 8: 126,478,927 (GRCm39) M2107K probably damaging Het
Pgd A T 4: 149,241,048 (GRCm39) probably benign Het
Prim2 T C 1: 33,503,145 (GRCm39) M430V probably benign Het
Prkaa1 A G 15: 5,190,101 (GRCm39) T40A probably damaging Het
Ptges T C 2: 30,793,232 (GRCm39) probably benign Het
Ptprn T C 1: 75,234,909 (GRCm39) E226G probably benign Het
Rab14 A G 2: 35,079,978 (GRCm39) F55S probably damaging Het
Ralgps2 A T 1: 156,684,637 (GRCm39) probably benign Het
Rgs11 C T 17: 26,426,542 (GRCm39) H258Y probably benign Het
Rhpn2 T C 7: 35,075,774 (GRCm39) probably null Het
Rprd2 A T 3: 95,681,483 (GRCm39) V452E probably damaging Het
Scube3 C A 17: 28,384,989 (GRCm39) H646Q probably damaging Het
Selp A T 1: 163,953,909 (GRCm39) I70F probably damaging Het
Septin2 A G 1: 93,426,849 (GRCm39) I153V probably damaging Het
Sh3rf3 G A 10: 58,649,905 (GRCm39) S170N probably benign Het
Skint4 A T 4: 112,000,963 (GRCm39) I353F possibly damaging Het
Slc16a12 A G 19: 34,657,780 (GRCm39) I41T possibly damaging Het
Snai2 T C 16: 14,524,881 (GRCm39) F129S probably damaging Het
Top3b C T 16: 16,708,526 (GRCm39) R629* probably null Het
Trim17 T A 11: 58,862,270 (GRCm39) V434E probably damaging Het
Ttn G A 2: 76,615,327 (GRCm39) P15051L probably damaging Het
Uggt2 A T 14: 119,239,259 (GRCm39) I1391N probably damaging Het
Usp8 A T 2: 126,596,958 (GRCm39) M923L probably damaging Het
Vmn1r176 T C 7: 23,534,463 (GRCm39) H230R possibly damaging Het
Vmn1r217 C A 13: 23,298,159 (GRCm39) D248Y probably damaging Het
Vmn2r14 A T 5: 109,363,976 (GRCm39) C647S probably damaging Het
Vwa5b1 A G 4: 138,332,851 (GRCm39) I237T probably damaging Het
Zan T A 5: 137,391,423 (GRCm39) D4687V unknown Het
Zfp273 T C 13: 67,973,484 (GRCm39) V204A probably benign Het
Zfp956 T G 6: 47,928,987 (GRCm39) probably benign Het
Other mutations in Herc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Herc1 APN 9 66,391,248 (GRCm39) missense probably benign 0.02
IGL00159:Herc1 APN 9 66,344,964 (GRCm39) missense possibly damaging 0.94
IGL00486:Herc1 APN 9 66,383,402 (GRCm39) missense probably benign
IGL00717:Herc1 APN 9 66,392,284 (GRCm39) missense probably damaging 1.00
IGL00766:Herc1 APN 9 66,358,023 (GRCm39) missense probably damaging 1.00
IGL00776:Herc1 APN 9 66,328,320 (GRCm39) missense probably benign
IGL00987:Herc1 APN 9 66,315,334 (GRCm39) missense probably benign 0.07
IGL01090:Herc1 APN 9 66,376,457 (GRCm39) nonsense probably null
IGL01098:Herc1 APN 9 66,369,204 (GRCm39) critical splice donor site probably null
IGL01106:Herc1 APN 9 66,383,720 (GRCm39) splice site probably benign
IGL01120:Herc1 APN 9 66,336,162 (GRCm39) missense probably benign
IGL01359:Herc1 APN 9 66,346,550 (GRCm39) missense probably benign 0.01
IGL01360:Herc1 APN 9 66,390,981 (GRCm39) missense probably benign
IGL01364:Herc1 APN 9 66,306,643 (GRCm39) missense probably benign 0.00
IGL01470:Herc1 APN 9 66,404,918 (GRCm39) missense possibly damaging 0.94
IGL01670:Herc1 APN 9 66,394,342 (GRCm39) missense probably damaging 1.00
IGL01825:Herc1 APN 9 66,307,089 (GRCm39) missense probably benign 0.00
IGL01903:Herc1 APN 9 66,294,154 (GRCm39) nonsense probably null
IGL01988:Herc1 APN 9 66,395,357 (GRCm39) splice site probably benign
IGL02074:Herc1 APN 9 66,358,265 (GRCm39) missense probably benign
IGL02089:Herc1 APN 9 66,388,151 (GRCm39) missense probably damaging 1.00
IGL02177:Herc1 APN 9 66,341,793 (GRCm39) missense probably benign
IGL02300:Herc1 APN 9 66,383,645 (GRCm39) missense probably benign 0.01
IGL02304:Herc1 APN 9 66,383,696 (GRCm39) missense probably benign 0.06
IGL02369:Herc1 APN 9 66,399,293 (GRCm39) nonsense probably null
IGL02445:Herc1 APN 9 66,340,764 (GRCm39) missense possibly damaging 0.95
IGL02447:Herc1 APN 9 66,404,610 (GRCm39) missense possibly damaging 0.59
IGL02549:Herc1 APN 9 66,307,183 (GRCm39) missense probably damaging 0.98
IGL02571:Herc1 APN 9 66,341,887 (GRCm39) splice site probably benign
IGL02709:Herc1 APN 9 66,404,962 (GRCm39) missense probably damaging 0.97
IGL02717:Herc1 APN 9 66,279,203 (GRCm39) nonsense probably null
IGL02726:Herc1 APN 9 66,349,270 (GRCm39) missense probably benign 0.37
IGL02733:Herc1 APN 9 66,358,274 (GRCm39) missense probably benign
IGL02963:Herc1 APN 9 66,296,105 (GRCm39) missense probably damaging 0.99
IGL03101:Herc1 APN 9 66,395,279 (GRCm39) missense probably benign
IGL03193:Herc1 APN 9 66,309,962 (GRCm39) missense probably benign
IGL03203:Herc1 APN 9 66,296,182 (GRCm39) critical splice donor site probably null
IGL03216:Herc1 APN 9 66,386,228 (GRCm39) missense probably benign 0.06
IGL03282:Herc1 APN 9 66,358,741 (GRCm39) missense probably benign 0.05
IGL03295:Herc1 APN 9 66,303,985 (GRCm39) missense possibly damaging 0.56
cradle UTSW 9 66,391,148 (GRCm39) splice site probably null
miracles UTSW 9 66,370,119 (GRCm39) nonsense probably null
newton UTSW 9 66,375,085 (GRCm39) missense probably damaging 1.00
R0907_Herc1_362 UTSW 9 66,340,710 (GRCm39) missense possibly damaging 0.94
R4427_Herc1_231 UTSW 9 66,403,287 (GRCm39) missense probably damaging 1.00
R5026_Herc1_363 UTSW 9 66,393,408 (GRCm39) missense probably benign 0.03
stables UTSW 9 66,386,735 (GRCm39) missense probably benign 0.13
strangle UTSW 9 66,408,470 (GRCm39) frame shift probably null
IGL03134:Herc1 UTSW 9 66,341,345 (GRCm39) critical splice acceptor site probably benign
PIT4243001:Herc1 UTSW 9 66,279,489 (GRCm39) missense probably benign 0.00
PIT4486001:Herc1 UTSW 9 66,279,671 (GRCm39) missense probably damaging 1.00
PIT4696001:Herc1 UTSW 9 66,386,291 (GRCm39) missense probably damaging 1.00
R0044:Herc1 UTSW 9 66,355,457 (GRCm39) missense probably benign 0.04
R0044:Herc1 UTSW 9 66,355,457 (GRCm39) missense probably benign 0.04
R0052:Herc1 UTSW 9 66,307,438 (GRCm39) missense probably damaging 0.99
R0114:Herc1 UTSW 9 66,369,128 (GRCm39) missense probably damaging 0.99
R0129:Herc1 UTSW 9 66,355,357 (GRCm39) missense probably damaging 1.00
R0131:Herc1 UTSW 9 66,388,192 (GRCm39) missense probably benign 0.00
R0131:Herc1 UTSW 9 66,388,192 (GRCm39) missense probably benign 0.00
R0132:Herc1 UTSW 9 66,388,192 (GRCm39) missense probably benign 0.00
R0158:Herc1 UTSW 9 66,403,203 (GRCm39) nonsense probably null
R0333:Herc1 UTSW 9 66,371,981 (GRCm39) splice site probably null
R0384:Herc1 UTSW 9 66,388,332 (GRCm39) splice site probably benign
R0419:Herc1 UTSW 9 66,353,356 (GRCm39) splice site probably benign
R0453:Herc1 UTSW 9 66,307,054 (GRCm39) missense probably benign 0.20
R0458:Herc1 UTSW 9 66,383,663 (GRCm39) missense probably benign 0.12
R0490:Herc1 UTSW 9 66,392,281 (GRCm39) missense probably damaging 1.00
R0506:Herc1 UTSW 9 66,355,441 (GRCm39) missense probably damaging 0.99
R0513:Herc1 UTSW 9 66,352,927 (GRCm39) missense possibly damaging 0.96
R0628:Herc1 UTSW 9 66,358,163 (GRCm39) missense probably benign 0.35
R0666:Herc1 UTSW 9 66,392,170 (GRCm39) splice site probably benign
R0674:Herc1 UTSW 9 66,408,474 (GRCm39) missense probably damaging 0.99
R0682:Herc1 UTSW 9 66,389,263 (GRCm39) missense possibly damaging 0.95
R0690:Herc1 UTSW 9 66,294,120 (GRCm39) nonsense probably null
R0701:Herc1 UTSW 9 66,395,232 (GRCm39) missense probably damaging 1.00
R0766:Herc1 UTSW 9 66,412,122 (GRCm39) missense probably damaging 1.00
R0850:Herc1 UTSW 9 66,373,952 (GRCm39) missense probably damaging 1.00
R0907:Herc1 UTSW 9 66,340,710 (GRCm39) missense possibly damaging 0.94
R0972:Herc1 UTSW 9 66,279,427 (GRCm39) missense probably damaging 1.00
R0976:Herc1 UTSW 9 66,347,160 (GRCm39) missense possibly damaging 0.74
R1027:Herc1 UTSW 9 66,363,250 (GRCm39) missense probably benign
R1200:Herc1 UTSW 9 66,393,406 (GRCm39) missense probably damaging 1.00
R1226:Herc1 UTSW 9 66,323,545 (GRCm39) missense probably benign 0.00
R1364:Herc1 UTSW 9 66,307,375 (GRCm39) missense probably damaging 1.00
R1395:Herc1 UTSW 9 66,346,463 (GRCm39) missense probably benign 0.13
R1432:Herc1 UTSW 9 66,372,751 (GRCm39) missense probably benign 0.13
R1440:Herc1 UTSW 9 66,375,085 (GRCm39) missense probably damaging 1.00
R1476:Herc1 UTSW 9 66,415,548 (GRCm39) missense probably damaging 1.00
R1590:Herc1 UTSW 9 66,399,235 (GRCm39) splice site probably benign
R1634:Herc1 UTSW 9 66,380,820 (GRCm39) missense possibly damaging 0.51
R1700:Herc1 UTSW 9 66,357,960 (GRCm39) splice site probably null
R1753:Herc1 UTSW 9 66,409,366 (GRCm39) critical splice donor site probably null
R1753:Herc1 UTSW 9 66,376,292 (GRCm39) missense probably damaging 1.00
R1796:Herc1 UTSW 9 66,296,138 (GRCm39) nonsense probably null
R1830:Herc1 UTSW 9 66,404,881 (GRCm39) missense possibly damaging 0.95
R1855:Herc1 UTSW 9 66,298,708 (GRCm39) missense possibly damaging 0.95
R1866:Herc1 UTSW 9 66,358,073 (GRCm39) missense probably damaging 1.00
R1894:Herc1 UTSW 9 66,386,743 (GRCm39) missense probably damaging 1.00
R1918:Herc1 UTSW 9 66,383,408 (GRCm39) splice site probably null
R1999:Herc1 UTSW 9 66,393,360 (GRCm39) missense probably benign 0.07
R2034:Herc1 UTSW 9 66,349,254 (GRCm39) missense probably benign 0.01
R2138:Herc1 UTSW 9 66,377,589 (GRCm39) missense possibly damaging 0.94
R2186:Herc1 UTSW 9 66,347,183 (GRCm39) missense probably benign 0.45
R2192:Herc1 UTSW 9 66,372,688 (GRCm39) missense probably damaging 0.99
R2312:Herc1 UTSW 9 66,415,563 (GRCm39) nonsense probably null
R2338:Herc1 UTSW 9 66,336,251 (GRCm39) missense possibly damaging 0.69
R3035:Herc1 UTSW 9 66,391,217 (GRCm39) missense possibly damaging 0.89
R3732:Herc1 UTSW 9 66,352,922 (GRCm39) missense probably damaging 1.00
R3732:Herc1 UTSW 9 66,352,922 (GRCm39) missense probably damaging 1.00
R3733:Herc1 UTSW 9 66,352,922 (GRCm39) missense probably damaging 1.00
R3917:Herc1 UTSW 9 66,341,748 (GRCm39) missense possibly damaging 0.94
R3953:Herc1 UTSW 9 66,341,075 (GRCm39) nonsense probably null
R4073:Herc1 UTSW 9 66,325,774 (GRCm39) missense probably benign 0.12
R4075:Herc1 UTSW 9 66,325,774 (GRCm39) missense probably benign 0.12
R4241:Herc1 UTSW 9 66,355,630 (GRCm39) frame shift probably null
R4260:Herc1 UTSW 9 66,355,630 (GRCm39) frame shift probably null
R4261:Herc1 UTSW 9 66,355,630 (GRCm39) frame shift probably null
R4300:Herc1 UTSW 9 66,396,688 (GRCm39) missense probably damaging 1.00
R4398:Herc1 UTSW 9 66,386,735 (GRCm39) missense probably benign 0.13
R4426:Herc1 UTSW 9 66,403,287 (GRCm39) missense probably damaging 1.00
R4427:Herc1 UTSW 9 66,403,287 (GRCm39) missense probably damaging 1.00
R4590:Herc1 UTSW 9 66,344,946 (GRCm39) missense probably damaging 0.97
R4630:Herc1 UTSW 9 66,340,996 (GRCm39) splice site probably null
R4656:Herc1 UTSW 9 66,301,993 (GRCm39) missense probably damaging 0.97
R4658:Herc1 UTSW 9 66,386,773 (GRCm39) missense possibly damaging 0.50
R4663:Herc1 UTSW 9 66,340,660 (GRCm39) missense probably damaging 0.98
R4675:Herc1 UTSW 9 66,298,740 (GRCm39) missense probably damaging 1.00
R4678:Herc1 UTSW 9 66,323,551 (GRCm39) missense probably benign 0.00
R4754:Herc1 UTSW 9 66,408,488 (GRCm39) missense probably benign 0.00
R4766:Herc1 UTSW 9 66,349,211 (GRCm39) missense probably benign 0.00
R4792:Herc1 UTSW 9 66,403,266 (GRCm39) missense possibly damaging 0.67
R4828:Herc1 UTSW 9 66,404,625 (GRCm39) splice site probably null
R4879:Herc1 UTSW 9 66,370,119 (GRCm39) nonsense probably null
R4948:Herc1 UTSW 9 66,392,184 (GRCm39) missense probably benign
R5021:Herc1 UTSW 9 66,377,608 (GRCm39) missense possibly damaging 0.48
R5022:Herc1 UTSW 9 66,377,608 (GRCm39) missense possibly damaging 0.48
R5023:Herc1 UTSW 9 66,377,608 (GRCm39) missense possibly damaging 0.48
R5024:Herc1 UTSW 9 66,377,608 (GRCm39) missense possibly damaging 0.48
R5025:Herc1 UTSW 9 66,377,608 (GRCm39) missense possibly damaging 0.48
R5026:Herc1 UTSW 9 66,393,408 (GRCm39) missense probably benign 0.03
R5027:Herc1 UTSW 9 66,380,811 (GRCm39) missense probably benign 0.01
R5027:Herc1 UTSW 9 66,411,900 (GRCm39) missense probably damaging 0.98
R5038:Herc1 UTSW 9 66,383,742 (GRCm39) intron probably benign
R5041:Herc1 UTSW 9 66,336,327 (GRCm39) missense possibly damaging 0.86
R5053:Herc1 UTSW 9 66,377,608 (GRCm39) missense possibly damaging 0.48
R5137:Herc1 UTSW 9 66,355,505 (GRCm39) missense probably benign
R5197:Herc1 UTSW 9 66,355,786 (GRCm39) missense probably damaging 0.99
R5207:Herc1 UTSW 9 66,307,151 (GRCm39) nonsense probably null
R5247:Herc1 UTSW 9 66,341,833 (GRCm39) missense probably benign 0.01
R5267:Herc1 UTSW 9 66,369,091 (GRCm39) missense probably damaging 1.00
R5274:Herc1 UTSW 9 66,306,691 (GRCm39) missense probably benign
R5375:Herc1 UTSW 9 66,375,169 (GRCm39) missense probably damaging 0.99
R5401:Herc1 UTSW 9 66,409,338 (GRCm39) missense probably damaging 1.00
R5560:Herc1 UTSW 9 66,358,401 (GRCm39) missense probably benign 0.02
R5566:Herc1 UTSW 9 66,372,819 (GRCm39) missense possibly damaging 0.95
R5577:Herc1 UTSW 9 66,389,263 (GRCm39) missense probably damaging 0.99
R5596:Herc1 UTSW 9 66,341,345 (GRCm39) critical splice acceptor site probably benign
R5665:Herc1 UTSW 9 66,372,717 (GRCm39) missense probably damaging 1.00
R5744:Herc1 UTSW 9 66,415,475 (GRCm39) missense probably damaging 1.00
R5802:Herc1 UTSW 9 66,370,160 (GRCm39) missense probably damaging 1.00
R5822:Herc1 UTSW 9 66,352,894 (GRCm39) missense probably benign 0.00
R5954:Herc1 UTSW 9 66,358,774 (GRCm39) splice site probably benign
R5977:Herc1 UTSW 9 66,340,604 (GRCm39) missense possibly damaging 0.77
R6022:Herc1 UTSW 9 66,390,967 (GRCm39) missense probably damaging 1.00
R6043:Herc1 UTSW 9 66,315,436 (GRCm39) missense probably benign
R6046:Herc1 UTSW 9 66,352,831 (GRCm39) missense probably damaging 0.99
R6089:Herc1 UTSW 9 66,352,814 (GRCm39) missense probably damaging 1.00
R6123:Herc1 UTSW 9 66,404,532 (GRCm39) missense probably damaging 0.97
R6155:Herc1 UTSW 9 66,340,705 (GRCm39) missense possibly damaging 0.95
R6190:Herc1 UTSW 9 66,283,663 (GRCm39) missense possibly damaging 0.56
R6220:Herc1 UTSW 9 66,341,070 (GRCm39) missense probably damaging 1.00
R6265:Herc1 UTSW 9 66,279,298 (GRCm39) missense probably benign 0.05
R6348:Herc1 UTSW 9 66,395,258 (GRCm39) missense possibly damaging 0.77
R6362:Herc1 UTSW 9 66,379,190 (GRCm39) missense probably damaging 1.00
R6394:Herc1 UTSW 9 66,302,341 (GRCm39) missense probably damaging 0.99
R6434:Herc1 UTSW 9 66,393,464 (GRCm39) missense probably damaging 0.99
R6483:Herc1 UTSW 9 66,355,811 (GRCm39) missense possibly damaging 0.64
R6607:Herc1 UTSW 9 66,325,849 (GRCm39) missense probably benign 0.02
R6633:Herc1 UTSW 9 66,346,534 (GRCm39) nonsense probably null
R6634:Herc1 UTSW 9 66,345,026 (GRCm39) missense probably benign
R6693:Herc1 UTSW 9 66,386,258 (GRCm39) missense probably damaging 0.99
R6695:Herc1 UTSW 9 66,391,148 (GRCm39) splice site probably null
R6748:Herc1 UTSW 9 66,408,470 (GRCm39) frame shift probably null
R6750:Herc1 UTSW 9 66,408,470 (GRCm39) frame shift probably null
R6751:Herc1 UTSW 9 66,408,470 (GRCm39) frame shift probably null
R6774:Herc1 UTSW 9 66,408,470 (GRCm39) frame shift probably null
R6785:Herc1 UTSW 9 66,408,470 (GRCm39) frame shift probably null
R6786:Herc1 UTSW 9 66,408,470 (GRCm39) frame shift probably null
R6856:Herc1 UTSW 9 66,305,180 (GRCm39) missense probably benign 0.05
R6966:Herc1 UTSW 9 66,318,347 (GRCm39) missense probably benign 0.07
R7020:Herc1 UTSW 9 66,393,360 (GRCm39) missense probably benign 0.07
R7109:Herc1 UTSW 9 66,389,171 (GRCm39) missense probably benign 0.03
R7122:Herc1 UTSW 9 66,307,056 (GRCm39) missense possibly damaging 0.69
R7209:Herc1 UTSW 9 66,292,314 (GRCm39) missense possibly damaging 0.95
R7222:Herc1 UTSW 9 66,374,781 (GRCm39) missense probably damaging 0.98
R7303:Herc1 UTSW 9 66,358,098 (GRCm39) missense possibly damaging 0.93
R7305:Herc1 UTSW 9 66,369,150 (GRCm39) missense
R7438:Herc1 UTSW 9 66,302,038 (GRCm39) missense probably benign 0.00
R7535:Herc1 UTSW 9 66,382,135 (GRCm39) missense probably damaging 1.00
R7585:Herc1 UTSW 9 66,352,829 (GRCm39) missense probably damaging 1.00
R7603:Herc1 UTSW 9 66,358,665 (GRCm39) nonsense probably null
R7670:Herc1 UTSW 9 66,323,629 (GRCm39) missense probably damaging 0.99
R7705:Herc1 UTSW 9 66,347,116 (GRCm39) missense possibly damaging 0.86
R7723:Herc1 UTSW 9 66,279,158 (GRCm39) missense probably benign 0.24
R7730:Herc1 UTSW 9 66,400,472 (GRCm39) small deletion probably benign
R7880:Herc1 UTSW 9 66,415,506 (GRCm39) missense probably damaging 0.99
R7958:Herc1 UTSW 9 66,393,475 (GRCm39) missense probably damaging 1.00
R7976:Herc1 UTSW 9 66,341,552 (GRCm39) missense possibly damaging 0.94
R8006:Herc1 UTSW 9 66,352,842 (GRCm39) nonsense probably null
R8084:Herc1 UTSW 9 66,383,217 (GRCm39) missense probably benign 0.45
R8094:Herc1 UTSW 9 66,400,462 (GRCm39) missense probably damaging 0.98
R8099:Herc1 UTSW 9 66,279,422 (GRCm39) missense probably damaging 1.00
R8151:Herc1 UTSW 9 66,341,073 (GRCm39) missense probably damaging 0.98
R8159:Herc1 UTSW 9 66,369,003 (GRCm39) missense probably null
R8190:Herc1 UTSW 9 66,325,733 (GRCm39) missense probably benign 0.00
R8213:Herc1 UTSW 9 66,358,170 (GRCm39) missense probably damaging 0.99
R8230:Herc1 UTSW 9 66,377,598 (GRCm39) missense probably damaging 0.99
R8265:Herc1 UTSW 9 66,293,986 (GRCm39) nonsense probably null
R8270:Herc1 UTSW 9 66,395,232 (GRCm39) missense probably damaging 1.00
R8353:Herc1 UTSW 9 66,415,571 (GRCm39) missense possibly damaging 0.88
R8423:Herc1 UTSW 9 66,415,442 (GRCm39) missense probably damaging 0.99
R8506:Herc1 UTSW 9 66,380,863 (GRCm39) missense possibly damaging 0.52
R8523:Herc1 UTSW 9 66,358,224 (GRCm39) missense probably benign
R8530:Herc1 UTSW 9 66,325,910 (GRCm39) missense probably benign
R8545:Herc1 UTSW 9 66,279,257 (GRCm39) nonsense probably null
R8682:Herc1 UTSW 9 66,370,130 (GRCm39) missense
R8720:Herc1 UTSW 9 66,389,105 (GRCm39) missense probably benign 0.38
R8792:Herc1 UTSW 9 66,372,768 (GRCm39) missense probably damaging 1.00
R8915:Herc1 UTSW 9 66,318,456 (GRCm39) missense probably damaging 1.00
R8964:Herc1 UTSW 9 66,352,872 (GRCm39) missense probably damaging 1.00
R9056:Herc1 UTSW 9 66,380,782 (GRCm39) missense probably benign 0.10
R9158:Herc1 UTSW 9 66,376,400 (GRCm39) missense probably benign 0.00
R9167:Herc1 UTSW 9 66,411,900 (GRCm39) missense possibly damaging 0.75
R9192:Herc1 UTSW 9 66,321,413 (GRCm39) missense probably benign 0.35
R9252:Herc1 UTSW 9 66,309,834 (GRCm39) missense probably damaging 1.00
R9260:Herc1 UTSW 9 66,325,691 (GRCm39) nonsense probably null
R9261:Herc1 UTSW 9 66,412,129 (GRCm39) missense probably damaging 0.98
R9430:Herc1 UTSW 9 66,325,785 (GRCm39) nonsense probably null
R9519:Herc1 UTSW 9 66,307,356 (GRCm39) missense probably damaging 0.97
R9563:Herc1 UTSW 9 66,294,193 (GRCm39) critical splice donor site probably null
R9589:Herc1 UTSW 9 66,372,840 (GRCm39) missense possibly damaging 0.95
R9600:Herc1 UTSW 9 66,304,594 (GRCm39) missense possibly damaging 0.95
R9659:Herc1 UTSW 9 66,307,185 (GRCm39) missense probably benign 0.03
R9740:Herc1 UTSW 9 66,355,796 (GRCm39) missense probably damaging 1.00
R9774:Herc1 UTSW 9 66,372,032 (GRCm39) missense probably null
R9781:Herc1 UTSW 9 66,280,004 (GRCm39) missense probably benign
R9788:Herc1 UTSW 9 66,307,185 (GRCm39) missense probably benign 0.03
RF023:Herc1 UTSW 9 66,365,616 (GRCm39) missense
X0011:Herc1 UTSW 9 66,307,441 (GRCm39) missense probably benign 0.28
X0067:Herc1 UTSW 9 66,355,806 (GRCm39) missense probably benign 0.03
Z1176:Herc1 UTSW 9 66,341,858 (GRCm39) missense probably benign
Z1177:Herc1 UTSW 9 66,379,193 (GRCm39) missense probably damaging 0.99
Z1177:Herc1 UTSW 9 66,365,707 (GRCm39) missense probably null
Predicted Primers PCR Primer
(F):5'- TGGGTAGAGGAATAGATATCTCTGTAG -3'
(R):5'- AAGAGCATAACACATTAGCCATGAG -3'

Sequencing Primer
(F):5'- TTGACAAGTGCCTCTGTG -3'
(R):5'- TAGCCATGAGAGAAGTTTTTAAAGGC -3'
Posted On 2016-03-01