Incidental Mutation 'R4833:Mknk1'
ID372971
Institutional Source Beutler Lab
Gene Symbol Mknk1
Ensembl Gene ENSMUSG00000028708
Gene NameMAP kinase-interacting serine/threonine kinase 1
SynonymsMnk1, 2410048M24Rik
MMRRC Submission 042449-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4833 (G1)
Quality Score138
Status Validated
Chromosome4
Chromosomal Location115839198-115879250 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) C to T at 115878186 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019677] [ENSMUST00000106513]
Predicted Effect probably benign
Transcript: ENSMUST00000019677
SMART Domains Protein: ENSMUSP00000019677
Gene: ENSMUSG00000028708

DomainStartEndE-ValueType
low complexity region 14 21 N/A INTRINSIC
S_TKc 37 321 2.01e-87 SMART
low complexity region 363 378 N/A INTRINSIC
low complexity region 383 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106513
SMART Domains Protein: ENSMUSP00000102123
Gene: ENSMUSG00000028708

DomainStartEndE-ValueType
low complexity region 14 21 N/A INTRINSIC
S_TKc 37 321 2.01e-87 SMART
low complexity region 363 378 N/A INTRINSIC
low complexity region 383 404 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187426
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: This gene encodes a serine-threonine protein kinase that is activated by extracellular signal-regulated kinase or p38 mitogen-activated protein kinases, and it may function in cytokine and environmental stress responses. This kinase is required for phosphorylation of eukaryotic translation initiation factor 4E but it is not required for cell growth during development. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous null mice are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C A 19: 3,716,872 T153K possibly damaging Het
4932438A13Rik A G 3: 36,964,968 I2007V probably damaging Het
Abca5 A C 11: 110,279,316 Y1318D probably benign Het
Adam18 A G 8: 24,674,101 I22T probably benign Het
Adgrv1 T A 13: 81,560,844 H1147L possibly damaging Het
Ankrd2 T C 19: 42,043,857 probably null Het
Bdkrb2 T C 12: 105,591,658 W53R probably benign Het
Blm T A 7: 80,466,826 I1111L probably benign Het
Bmp3 T G 5: 98,855,207 L32R probably damaging Het
Cdh23 T G 10: 60,385,038 E1312A probably damaging Het
Ceacam5 C T 7: 17,752,258 T560M probably benign Het
Cmtm8 C A 9: 114,796,165 R66I probably benign Het
Cnbd1 A G 4: 18,862,120 Y357H probably damaging Het
Col4a4 A T 1: 82,529,602 V252E unknown Het
Col6a4 A T 9: 106,071,979 M819K probably benign Het
Cwf19l2 T C 9: 3,430,783 S372P probably benign Het
Daam2 A T 17: 49,490,145 I204N possibly damaging Het
Dock6 T C 9: 21,844,280 D216G probably damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Erich2 T C 2: 70,534,292 Y311H possibly damaging Het
Gm3985 A G 8: 32,890,477 noncoding transcript Het
Gnb1 A G 4: 155,543,067 T102A possibly damaging Het
Hcfc2 C T 10: 82,709,146 A204V probably null Het
Hnrnpu T C 1: 178,333,894 probably benign Het
Htt A G 5: 34,852,225 T1517A probably damaging Het
Klhl6 T A 16: 19,957,139 D223V probably damaging Het
Kpna6 A G 4: 129,657,779 S71P possibly damaging Het
Lama3 A G 18: 12,441,131 D590G probably benign Het
Lipt1 T G 1: 37,875,529 L222R probably damaging Het
Lrrc41 A G 4: 116,093,177 probably benign Het
Lrrc59 T C 11: 94,634,672 V98A probably benign Het
Mast4 A G 13: 102,774,184 probably null Het
Mdc1 C T 17: 35,850,394 S733F probably benign Het
Mtmr7 A G 8: 40,590,462 F141S probably damaging Het
Myo15b A G 11: 115,887,602 D1G possibly damaging Het
Odf3 T C 7: 140,848,278 M1T probably null Het
Olfr1356 T G 10: 78,847,575 L113F probably damaging Het
Phkb T A 8: 85,901,911 V183E probably damaging Het
Pola2 T C 19: 5,953,864 Y161C probably damaging Het
Psen1 G A 12: 83,731,778 V412I probably benign Het
Psmc4 C A 7: 28,047,512 G77V probably damaging Het
Psmd3 A G 11: 98,687,760 Y207C probably damaging Het
Pxk T A 14: 8,130,653 M84K probably damaging Het
Rab44 A C 17: 29,136,337 Q19P probably damaging Het
Rbks A G 5: 31,624,515 Y314H probably benign Het
Rftn2 T C 1: 55,214,240 D68G possibly damaging Het
Rims2 T A 15: 39,535,914 S838R probably damaging Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Slfn14 A G 11: 83,279,156 L554P probably damaging Het
Spink2 G T 5: 77,205,392 D83E possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Taar8b A T 10: 24,092,132 S55T possibly damaging Het
Tbca A G 13: 94,832,410 E35G probably benign Het
Tmc5 C A 7: 118,628,829 H307Q probably benign Het
Tmem169 A G 1: 72,298,152 D82G probably benign Het
Tmem72 T C 6: 116,698,358 T58A probably benign Het
Ttc7 C T 17: 87,334,321 P449S probably damaging Het
Ttf2 T C 3: 100,961,406 E449G probably benign Het
Ubr4 C A 4: 139,402,546 T659K probably damaging Het
Wdr1 A G 5: 38,547,029 Y98H probably damaging Het
Wfikkn2 A G 11: 94,239,052 Y88H probably benign Het
Zfp384 A T 6: 125,030,848 H247L probably damaging Het
Zfp526 C T 7: 25,225,870 A518V probably damaging Het
Zfp788 T A 7: 41,647,568 H47Q probably benign Het
Other mutations in Mknk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Mknk1 APN 4 115875534 missense probably damaging 1.00
IGL02538:Mknk1 APN 4 115860091 nonsense probably null
IGL02927:Mknk1 APN 4 115857091 missense probably damaging 1.00
R1845:Mknk1 UTSW 4 115873231 nonsense probably null
R1943:Mknk1 UTSW 4 115863026 missense probably damaging 0.98
R2278:Mknk1 UTSW 4 115875493 missense probably damaging 0.99
R4027:Mknk1 UTSW 4 115864561 missense probably damaging 0.99
R4604:Mknk1 UTSW 4 115878027 missense probably damaging 0.96
R5400:Mknk1 UTSW 4 115864552 missense probably damaging 1.00
R5400:Mknk1 UTSW 4 115864553 missense probably damaging 1.00
R5712:Mknk1 UTSW 4 115855006 splice site probably null
R5941:Mknk1 UTSW 4 115876637 splice site probably benign
R7038:Mknk1 UTSW 4 115857110 missense probably damaging 0.99
R7146:Mknk1 UTSW 4 115864592 missense probably damaging 0.99
R7606:Mknk1 UTSW 4 115877994 missense probably damaging 0.98
R7747:Mknk1 UTSW 4 115878072 missense possibly damaging 0.96
X0050:Mknk1 UTSW 4 115857055 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGCACCATGGACTTGACTCTC -3'
(R):5'- CTCCTTTGAAGACTCCAGGG -3'

Sequencing Primer
(F):5'- TGACTCTCTTCGCAGCTGAGG -3'
(R):5'- CTCCTTTGAAGACTCCAGGGAAATG -3'
Posted On2016-03-01