Incidental Mutation 'R4833:Epha5'
ID372981
Institutional Source Beutler Lab
Gene Symbol Epha5
Ensembl Gene ENSMUSG00000029245
Gene NameEph receptor A5
SynonymsRek7, Ehk1, Hek7, Cek7, bsk, Els1
MMRRC Submission 042449-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4833 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location84054761-84417382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84105891 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 548 (D548N)
Ref Sequence ENSEMBL: ENSMUSP00000109028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053733] [ENSMUST00000113398] [ENSMUST00000113399] [ENSMUST00000113401] [ENSMUST00000113403] [ENSMUST00000113406]
Predicted Effect probably benign
Transcript: ENSMUST00000053733
AA Change: D571N

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000060646
Gene: ENSMUSG00000029245
AA Change: D571N

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 307 387 1.92e-12 SMART
Pfam:EphA2_TM 413 511 2.1e-22 PFAM
TyrKc 514 771 9.33e-138 SMART
SAM 801 868 6.65e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113398
AA Change: D623N

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000109025
Gene: ENSMUSG00000029245
AA Change: D623N

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 359 439 1.92e-12 SMART
Pfam:EphA2_TM 465 563 8.4e-23 PFAM
TyrKc 566 823 9.33e-138 SMART
Pfam:SAM_1 854 894 7.2e-11 PFAM
Pfam:SAM_2 856 894 1.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113399
AA Change: D735N

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000109026
Gene: ENSMUSG00000029245
AA Change: D735N

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 577 675 3.4e-22 PFAM
TyrKc 678 935 9.33e-138 SMART
Pfam:SAM_1 966 1006 2.9e-10 PFAM
Pfam:SAM_2 968 1006 5.9e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113401
AA Change: D548N

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109028
Gene: ENSMUSG00000029245
AA Change: D548N

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 307 387 1.92e-12 SMART
Pfam:EphA2_TM 411 488 3.1e-30 PFAM
TyrKc 491 748 9.33e-138 SMART
Pfam:SAM_1 779 819 1.7e-10 PFAM
Pfam:SAM_2 781 819 3.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113403
AA Change: D735N

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000109030
Gene: ENSMUSG00000029245
AA Change: D735N

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 577 675 1.2e-25 PFAM
TyrKc 678 935 9.33e-138 SMART
SAM 965 1032 6.65e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113406
AA Change: D712N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000109033
Gene: ENSMUSG00000029245
AA Change: D712N

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 575 652 1.9e-30 PFAM
TyrKc 655 912 9.33e-138 SMART
SAM 942 1009 6.65e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154804
Meta Mutation Damage Score 0.0726 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous mutant mice are overtly normal but show abnormal retinal axon mapping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C A 19: 3,716,872 T153K possibly damaging Het
4932438A13Rik A G 3: 36,964,968 I2007V probably damaging Het
Abca5 A C 11: 110,279,316 Y1318D probably benign Het
Adam18 A G 8: 24,674,101 I22T probably benign Het
Adgrv1 T A 13: 81,560,844 H1147L possibly damaging Het
Ankrd2 T C 19: 42,043,857 probably null Het
Bdkrb2 T C 12: 105,591,658 W53R probably benign Het
Blm T A 7: 80,466,826 I1111L probably benign Het
Bmp3 T G 5: 98,855,207 L32R probably damaging Het
Cdh23 T G 10: 60,385,038 E1312A probably damaging Het
Ceacam5 C T 7: 17,752,258 T560M probably benign Het
Cmtm8 C A 9: 114,796,165 R66I probably benign Het
Cnbd1 A G 4: 18,862,120 Y357H probably damaging Het
Col4a4 A T 1: 82,529,602 V252E unknown Het
Col6a4 A T 9: 106,071,979 M819K probably benign Het
Cwf19l2 T C 9: 3,430,783 S372P probably benign Het
Daam2 A T 17: 49,490,145 I204N possibly damaging Het
Dock6 T C 9: 21,844,280 D216G probably damaging Het
Erich2 T C 2: 70,534,292 Y311H possibly damaging Het
Gm3985 A G 8: 32,890,477 noncoding transcript Het
Gnb1 A G 4: 155,543,067 T102A possibly damaging Het
Hcfc2 C T 10: 82,709,146 A204V probably null Het
Hnrnpu T C 1: 178,333,894 probably benign Het
Htt A G 5: 34,852,225 T1517A probably damaging Het
Klhl6 T A 16: 19,957,139 D223V probably damaging Het
Kpna6 A G 4: 129,657,779 S71P possibly damaging Het
Lama3 A G 18: 12,441,131 D590G probably benign Het
Lipt1 T G 1: 37,875,529 L222R probably damaging Het
Lrrc41 A G 4: 116,093,177 probably benign Het
Lrrc59 T C 11: 94,634,672 V98A probably benign Het
Mast4 A G 13: 102,774,184 probably null Het
Mdc1 C T 17: 35,850,394 S733F probably benign Het
Mknk1 C T 4: 115,878,186 probably benign Het
Mtmr7 A G 8: 40,590,462 F141S probably damaging Het
Myo15b A G 11: 115,887,602 D1G possibly damaging Het
Odf3 T C 7: 140,848,278 M1T probably null Het
Olfr1356 T G 10: 78,847,575 L113F probably damaging Het
Phkb T A 8: 85,901,911 V183E probably damaging Het
Pola2 T C 19: 5,953,864 Y161C probably damaging Het
Psen1 G A 12: 83,731,778 V412I probably benign Het
Psmc4 C A 7: 28,047,512 G77V probably damaging Het
Psmd3 A G 11: 98,687,760 Y207C probably damaging Het
Pxk T A 14: 8,130,653 M84K probably damaging Het
Rab44 A C 17: 29,136,337 Q19P probably damaging Het
Rbks A G 5: 31,624,515 Y314H probably benign Het
Rftn2 T C 1: 55,214,240 D68G possibly damaging Het
Rims2 T A 15: 39,535,914 S838R probably damaging Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Slfn14 A G 11: 83,279,156 L554P probably damaging Het
Spink2 G T 5: 77,205,392 D83E possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Taar8b A T 10: 24,092,132 S55T possibly damaging Het
Tbca A G 13: 94,832,410 E35G probably benign Het
Tmc5 C A 7: 118,628,829 H307Q probably benign Het
Tmem169 A G 1: 72,298,152 D82G probably benign Het
Tmem72 T C 6: 116,698,358 T58A probably benign Het
Ttc7 C T 17: 87,334,321 P449S probably damaging Het
Ttf2 T C 3: 100,961,406 E449G probably benign Het
Ubr4 C A 4: 139,402,546 T659K probably damaging Het
Wdr1 A G 5: 38,547,029 Y98H probably damaging Het
Wfikkn2 A G 11: 94,239,052 Y88H probably benign Het
Zfp384 A T 6: 125,030,848 H247L probably damaging Het
Zfp526 C T 7: 25,225,870 A518V probably damaging Het
Zfp788 T A 7: 41,647,568 H47Q probably benign Het
Other mutations in Epha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Epha5 APN 5 84106700 missense probably damaging 1.00
IGL01084:Epha5 APN 5 84071087 nonsense probably null
IGL01462:Epha5 APN 5 84071233 missense probably damaging 1.00
IGL01516:Epha5 APN 5 84386276 missense probably damaging 1.00
IGL01998:Epha5 APN 5 84084734 missense probably damaging 1.00
IGL02744:Epha5 APN 5 84107989 missense probably benign 0.22
IGL03076:Epha5 APN 5 84331690 missense probably damaging 1.00
IGL03123:Epha5 APN 5 84331226 critical splice donor site probably null
IGL03381:Epha5 APN 5 84331332 missense probably damaging 0.98
BB001:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
BB011:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
PIT4544001:Epha5 UTSW 5 84331612 missense possibly damaging 0.71
R0004:Epha5 UTSW 5 84331842 missense probably damaging 1.00
R0490:Epha5 UTSW 5 84107974 splice site probably benign
R0545:Epha5 UTSW 5 84067358 critical splice donor site probably null
R0835:Epha5 UTSW 5 84386242 missense probably damaging 1.00
R1074:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1074:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1075:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1075:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1102:Epha5 UTSW 5 84233575 splice site probably benign
R1184:Epha5 UTSW 5 84071275 splice site probably null
R1255:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1255:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1327:Epha5 UTSW 5 84106785 missense probably damaging 1.00
R1437:Epha5 UTSW 5 84233696 missense probably damaging 1.00
R1804:Epha5 UTSW 5 84331815 missense probably benign 0.21
R1967:Epha5 UTSW 5 84416429 missense probably benign 0.23
R2187:Epha5 UTSW 5 84086364 missense probably damaging 1.00
R2282:Epha5 UTSW 5 84150410 missense probably damaging 1.00
R2899:Epha5 UTSW 5 84233808 missense probably damaging 0.99
R3746:Epha5 UTSW 5 84059104 missense probably damaging 1.00
R4454:Epha5 UTSW 5 84156444 missense probably damaging 1.00
R4771:Epha5 UTSW 5 84150419 missense probably damaging 0.99
R4809:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4810:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4825:Epha5 UTSW 5 84233840 missense probably damaging 0.97
R4961:Epha5 UTSW 5 84233643 missense probably damaging 1.00
R4976:Epha5 UTSW 5 84084824 missense probably damaging 1.00
R4981:Epha5 UTSW 5 84150483 missense probably damaging 1.00
R5149:Epha5 UTSW 5 84150358 missense probably damaging 1.00
R5422:Epha5 UTSW 5 84331490 missense probably damaging 1.00
R5575:Epha5 UTSW 5 84416502 missense probably damaging 0.97
R5664:Epha5 UTSW 5 84331866 missense probably damaging 1.00
R5801:Epha5 UTSW 5 84331226 critical splice donor site probably null
R5821:Epha5 UTSW 5 84084728 missense probably damaging 1.00
R5924:Epha5 UTSW 5 84233674 nonsense probably null
R5951:Epha5 UTSW 5 84331192 intron probably benign
R5956:Epha5 UTSW 5 84150369 missense probably damaging 0.99
R6127:Epha5 UTSW 5 84071094 missense probably damaging 1.00
R6189:Epha5 UTSW 5 84237540 missense probably damaging 1.00
R6240:Epha5 UTSW 5 84117579 missense probably benign 0.27
R6343:Epha5 UTSW 5 84106747 missense probably damaging 1.00
R6463:Epha5 UTSW 5 84106710 missense probably damaging 1.00
R6517:Epha5 UTSW 5 84156501 missense possibly damaging 0.63
R6622:Epha5 UTSW 5 84237528 missense possibly damaging 0.79
R6667:Epha5 UTSW 5 84071191 missense probably damaging 1.00
R6741:Epha5 UTSW 5 84106698 missense possibly damaging 0.69
R6757:Epha5 UTSW 5 84105878 missense probably damaging 1.00
R6762:Epha5 UTSW 5 84331726 missense probably damaging 1.00
R6819:Epha5 UTSW 5 84106790 missense probably damaging 1.00
R7019:Epha5 UTSW 5 84416462 missense possibly damaging 0.68
R7031:Epha5 UTSW 5 84142300 missense probably benign 0.12
R7213:Epha5 UTSW 5 84233923 splice site probably null
R7728:Epha5 UTSW 5 84067408 missense possibly damaging 0.95
R7924:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
R7953:Epha5 UTSW 5 84233654 missense probably benign 0.19
R8043:Epha5 UTSW 5 84233654 missense probably benign 0.19
Z1088:Epha5 UTSW 5 84237522 missense probably benign 0.01
Z1176:Epha5 UTSW 5 84071120 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AAGCCCTGATCATAATGGTGGG -3'
(R):5'- ACTGTGGACGTTTGGTCTCAC -3'

Sequencing Primer
(F):5'- CCTGATCATAATGGTGGGCATTTAAG -3'
(R):5'- CTGAACCTTAATCCTTCAGAAGTTTG -3'
Posted On2016-03-01