Incidental Mutation 'R4833:Blm'
ID372988
Institutional Source Beutler Lab
Gene Symbol Blm
Ensembl Gene ENSMUSG00000030528
Gene NameBloom syndrome, RecQ like helicase
Synonyms
MMRRC Submission 042449-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4833 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location80454733-80535119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80466826 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 1111 (I1111L)
Ref Sequence ENSEMBL: ENSMUSP00000127995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]
Predicted Effect probably benign
Transcript: ENSMUST00000081314
AA Change: I1108L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528
AA Change: I1108L

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 219 231 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
Pfam:BDHCT 376 416 5.5e-27 PFAM
low complexity region 557 574 N/A INTRINSIC
DEXDc 672 873 1.59e-29 SMART
HELICc 910 992 1.29e-24 SMART
RQC 1084 1198 1.43e-15 SMART
HRDC 1217 1297 9.4e-20 SMART
low complexity region 1357 1371 N/A INTRINSIC
low complexity region 1378 1392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170315
AA Change: I1111L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528
AA Change: I1111L

DomainStartEndE-ValueType
Pfam:BLM_N 4 375 1.1e-161 PFAM
Pfam:BDHCT 380 419 6.4e-25 PFAM
Pfam:BDHCT_assoc 433 658 8.8e-108 PFAM
DEXDc 675 876 1.59e-29 SMART
HELICc 913 995 1.29e-24 SMART
Pfam:RecQ_Zn_bind 1006 1078 1.5e-19 PFAM
RQC 1087 1201 1.43e-15 SMART
HRDC 1220 1300 9.4e-20 SMART
low complexity region 1360 1374 N/A INTRINSIC
low complexity region 1381 1395 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205713
Predicted Effect probably benign
Transcript: ENSMUST00000205730
Predicted Effect probably benign
Transcript: ENSMUST00000206901
Meta Mutation Damage Score 0.1207 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C A 19: 3,716,872 T153K possibly damaging Het
4932438A13Rik A G 3: 36,964,968 I2007V probably damaging Het
Abca5 A C 11: 110,279,316 Y1318D probably benign Het
Adam18 A G 8: 24,674,101 I22T probably benign Het
Adgrv1 T A 13: 81,560,844 H1147L possibly damaging Het
Ankrd2 T C 19: 42,043,857 probably null Het
Bdkrb2 T C 12: 105,591,658 W53R probably benign Het
Bmp3 T G 5: 98,855,207 L32R probably damaging Het
Cdh23 T G 10: 60,385,038 E1312A probably damaging Het
Ceacam5 C T 7: 17,752,258 T560M probably benign Het
Cmtm8 C A 9: 114,796,165 R66I probably benign Het
Cnbd1 A G 4: 18,862,120 Y357H probably damaging Het
Col4a4 A T 1: 82,529,602 V252E unknown Het
Col6a4 A T 9: 106,071,979 M819K probably benign Het
Cwf19l2 T C 9: 3,430,783 S372P probably benign Het
Daam2 A T 17: 49,490,145 I204N possibly damaging Het
Dock6 T C 9: 21,844,280 D216G probably damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Erich2 T C 2: 70,534,292 Y311H possibly damaging Het
Gm3985 A G 8: 32,890,477 noncoding transcript Het
Gnb1 A G 4: 155,543,067 T102A possibly damaging Het
Hcfc2 C T 10: 82,709,146 A204V probably null Het
Hnrnpu T C 1: 178,333,894 probably benign Het
Htt A G 5: 34,852,225 T1517A probably damaging Het
Klhl6 T A 16: 19,957,139 D223V probably damaging Het
Kpna6 A G 4: 129,657,779 S71P possibly damaging Het
Lama3 A G 18: 12,441,131 D590G probably benign Het
Lipt1 T G 1: 37,875,529 L222R probably damaging Het
Lrrc41 A G 4: 116,093,177 probably benign Het
Lrrc59 T C 11: 94,634,672 V98A probably benign Het
Mast4 A G 13: 102,774,184 probably null Het
Mdc1 C T 17: 35,850,394 S733F probably benign Het
Mknk1 C T 4: 115,878,186 probably benign Het
Mtmr7 A G 8: 40,590,462 F141S probably damaging Het
Myo15b A G 11: 115,887,602 D1G possibly damaging Het
Odf3 T C 7: 140,848,278 M1T probably null Het
Olfr1356 T G 10: 78,847,575 L113F probably damaging Het
Phkb T A 8: 85,901,911 V183E probably damaging Het
Pola2 T C 19: 5,953,864 Y161C probably damaging Het
Psen1 G A 12: 83,731,778 V412I probably benign Het
Psmc4 C A 7: 28,047,512 G77V probably damaging Het
Psmd3 A G 11: 98,687,760 Y207C probably damaging Het
Pxk T A 14: 8,130,653 M84K probably damaging Het
Rab44 A C 17: 29,136,337 Q19P probably damaging Het
Rbks A G 5: 31,624,515 Y314H probably benign Het
Rftn2 T C 1: 55,214,240 D68G possibly damaging Het
Rims2 T A 15: 39,535,914 S838R probably damaging Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Slfn14 A G 11: 83,279,156 L554P probably damaging Het
Spink2 G T 5: 77,205,392 D83E possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Taar8b A T 10: 24,092,132 S55T possibly damaging Het
Tbca A G 13: 94,832,410 E35G probably benign Het
Tmc5 C A 7: 118,628,829 H307Q probably benign Het
Tmem169 A G 1: 72,298,152 D82G probably benign Het
Tmem72 T C 6: 116,698,358 T58A probably benign Het
Ttc7 C T 17: 87,334,321 P449S probably damaging Het
Ttf2 T C 3: 100,961,406 E449G probably benign Het
Ubr4 C A 4: 139,402,546 T659K probably damaging Het
Wdr1 A G 5: 38,547,029 Y98H probably damaging Het
Wfikkn2 A G 11: 94,239,052 Y88H probably benign Het
Zfp384 A T 6: 125,030,848 H247L probably damaging Het
Zfp526 C T 7: 25,225,870 A518V probably damaging Het
Zfp788 T A 7: 41,647,568 H47Q probably benign Het
Other mutations in Blm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Blm APN 7 80474071 missense probably damaging 1.00
IGL01658:Blm APN 7 80463941 missense probably damaging 0.98
IGL02048:Blm APN 7 80502961 splice site probably benign
IGL02060:Blm APN 7 80514580 splice site probably benign
IGL02063:Blm APN 7 80509419 nonsense probably null
IGL02102:Blm APN 7 80469756 missense probably damaging 1.00
IGL02420:Blm APN 7 80496006 missense probably damaging 1.00
IGL02452:Blm APN 7 80503377 splice site probably null
IGL02566:Blm APN 7 80474196 missense probably damaging 1.00
IGL03387:Blm APN 7 80494147 missense probably damaging 1.00
FR4304:Blm UTSW 7 80463773 frame shift probably null
FR4304:Blm UTSW 7 80512919 small insertion probably benign
FR4340:Blm UTSW 7 80463767 unclassified probably benign
FR4340:Blm UTSW 7 80512907 small insertion probably benign
FR4340:Blm UTSW 7 80512910 small insertion probably benign
FR4449:Blm UTSW 7 80512908 small insertion probably benign
FR4548:Blm UTSW 7 80463769 frame shift probably null
FR4589:Blm UTSW 7 80463770 frame shift probably null
FR4737:Blm UTSW 7 80463771 frame shift probably null
FR4737:Blm UTSW 7 80463774 frame shift probably null
FR4976:Blm UTSW 7 80463767 unclassified probably benign
FR4976:Blm UTSW 7 80512907 small insertion probably benign
R0133:Blm UTSW 7 80502367 missense possibly damaging 0.93
R0194:Blm UTSW 7 80464946 unclassified probably benign
R0526:Blm UTSW 7 80505893 nonsense probably null
R0673:Blm UTSW 7 80499751 critical splice donor site probably null
R0972:Blm UTSW 7 80513370 missense probably benign
R0980:Blm UTSW 7 80499958 splice site probably null
R1120:Blm UTSW 7 80481466 missense probably damaging 1.00
R1301:Blm UTSW 7 80455417 nonsense probably null
R1769:Blm UTSW 7 80513370 missense probably benign
R1866:Blm UTSW 7 80494114 missense probably benign 0.08
R1874:Blm UTSW 7 80497418 missense probably damaging 1.00
R1966:Blm UTSW 7 80513186 missense possibly damaging 0.86
R1991:Blm UTSW 7 80505949 splice site probably null
R2013:Blm UTSW 7 80502399 missense probably damaging 0.99
R2014:Blm UTSW 7 80502399 missense probably damaging 0.99
R2015:Blm UTSW 7 80502399 missense probably damaging 0.99
R2016:Blm UTSW 7 80505926 missense probably benign 0.26
R2103:Blm UTSW 7 80505949 splice site probably null
R2161:Blm UTSW 7 80481370 intron probably null
R2215:Blm UTSW 7 80499847 missense possibly damaging 0.69
R3689:Blm UTSW 7 80513079 missense possibly damaging 0.56
R4049:Blm UTSW 7 80502862 missense probably benign 0.04
R4155:Blm UTSW 7 80512904 small deletion probably benign
R4695:Blm UTSW 7 80494228 missense probably damaging 1.00
R4774:Blm UTSW 7 80463848 missense probably damaging 1.00
R4835:Blm UTSW 7 80509546 missense probably benign 0.41
R4994:Blm UTSW 7 80458825 missense probably benign 0.00
R5039:Blm UTSW 7 80505873 missense possibly damaging 0.50
R5330:Blm UTSW 7 80458936 missense possibly damaging 0.73
R5375:Blm UTSW 7 80513229 missense probably benign 0.00
R5408:Blm UTSW 7 80502622 missense probably benign 0.01
R5574:Blm UTSW 7 80499773 missense probably damaging 1.00
R5606:Blm UTSW 7 80460832 intron probably null
R5702:Blm UTSW 7 80458927 missense probably benign 0.13
R5809:Blm UTSW 7 80464844 missense probably damaging 1.00
R6114:Blm UTSW 7 80513487 missense probably damaging 1.00
R6157:Blm UTSW 7 80512985 missense probably benign 0.18
R6163:Blm UTSW 7 80512904 small deletion probably benign
R6254:Blm UTSW 7 80480342 missense probably benign 0.04
R6266:Blm UTSW 7 80499940 missense probably benign 0.03
R6364:Blm UTSW 7 80494526 nonsense probably null
R6446:Blm UTSW 7 80512904 small deletion probably benign
R6502:Blm UTSW 7 80481475 missense probably damaging 0.98
R6700:Blm UTSW 7 80463850 missense possibly damaging 0.91
R7002:Blm UTSW 7 80469753 missense probably benign 0.00
R7105:Blm UTSW 7 80499768 missense probably benign 0.44
R7320:Blm UTSW 7 80455354 nonsense probably null
R7465:Blm UTSW 7 80513115 missense probably benign 0.02
R7561:Blm UTSW 7 80502528 missense probably damaging 0.99
RF001:Blm UTSW 7 80512903 small insertion probably benign
RF001:Blm UTSW 7 80512906 small insertion probably benign
RF001:Blm UTSW 7 80512927 small insertion probably benign
RF002:Blm UTSW 7 80512905 small insertion probably benign
RF002:Blm UTSW 7 80512927 small insertion probably benign
RF007:Blm UTSW 7 80512933 nonsense probably null
RF016:Blm UTSW 7 80512926 nonsense probably null
RF018:Blm UTSW 7 80512926 nonsense probably null
RF027:Blm UTSW 7 80512914 frame shift probably null
RF028:Blm UTSW 7 80512905 nonsense probably null
RF031:Blm UTSW 7 80512906 small insertion probably benign
RF031:Blm UTSW 7 80512923 small insertion probably benign
RF032:Blm UTSW 7 80512930 small insertion probably benign
RF036:Blm UTSW 7 80512914 nonsense probably null
RF044:Blm UTSW 7 80512930 small insertion probably benign
RF053:Blm UTSW 7 80512921 small insertion probably benign
RF064:Blm UTSW 7 80512923 nonsense probably null
X0061:Blm UTSW 7 80458850 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCACTTATAACCACTTCCTTAGATG -3'
(R):5'- GCGTGGAAACGAATTCTAAGTTTTACC -3'

Sequencing Primer
(F):5'- GTGAATACACTGTAGCTGTCAGACAC -3'
(R):5'- TTACCATACCATTAAGCTCCAGTG -3'
Posted On2016-03-01