Mutagenetix > Incidental Mutations

Incidental Mutation 'R4833:Blm'

372988

Institutional Source

Beutler Lab

Gene Symbol

Blm

Ensembl Gene

ENSMUSG00000030528

Gene Name

Bloom syndrome, RecQ like helicase

Synonyms

MMRRC Submission

042449-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4833 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80454733-80535119 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 80466826 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 1111 (I1111L)

Ref Sequence

ENSEMBL: ENSMUSP00000127995 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]

AlphaFold

O88700

Predicted Effect

probably benign
Transcript: ENSMUST00000081314
AA Change: I1108L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528
AA Change: I1108L

Domain	Start	End	E-Value	Type
low complexity region	46	54	N/A	INTRINSIC
low complexity region	118	132	N/A	INTRINSIC
low complexity region	142	169	N/A	INTRINSIC
low complexity region	219	231	N/A	INTRINSIC
low complexity region	318	335	N/A	INTRINSIC
Pfam:BDHCT	376	416	5.5e-27	PFAM
low complexity region	557	574	N/A	INTRINSIC
DEXDc	672	873	1.59e-29	SMART
HELICc	910	992	1.29e-24	SMART
RQC	1084	1198	1.43e-15	SMART
HRDC	1217	1297	9.4e-20	SMART
low complexity region	1357	1371	N/A	INTRINSIC
low complexity region	1378	1392	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170315
AA Change: I1111L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528
AA Change: I1111L

Domain	Start	End	E-Value	Type
Pfam:BLM_N	4	375	1.1e-161	PFAM
Pfam:BDHCT	380	419	6.4e-25	PFAM
Pfam:BDHCT_assoc	433	658	8.8e-108	PFAM
DEXDc	675	876	1.59e-29	SMART
HELICc	913	995	1.29e-24	SMART
Pfam:RecQ_Zn_bind	1006	1078	1.5e-19	PFAM
RQC	1087	1201	1.43e-15	SMART
HRDC	1220	1300	9.4e-20	SMART
low complexity region	1360	1374	N/A	INTRINSIC
low complexity region	1381	1395	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205263

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205713

Predicted Effect

probably benign
Transcript: ENSMUST00000205730

Predicted Effect

probably benign
Transcript: ENSMUST00000206901

Meta Mutation Damage Score

0.1207

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	C	A	19: 3,716,872	T153K	possibly damaging	Het
4932438A13Rik	A	G	3: 36,964,968	I2007V	probably damaging	Het
Abca5	A	C	11: 110,279,316	Y1318D	probably benign	Het
Adam18	A	G	8: 24,674,101	I22T	probably benign	Het
Adgrv1	T	A	13: 81,560,844	H1147L	possibly damaging	Het
Ankrd2	T	C	19: 42,043,857		probably null	Het
Bdkrb2	T	C	12: 105,591,658	W53R	probably benign	Het
Bmp3	T	G	5: 98,855,207	L32R	probably damaging	Het
Cdh23	T	G	10: 60,385,038	E1312A	probably damaging	Het
Ceacam5	C	T	7: 17,752,258	T560M	probably benign	Het
Cmtm8	C	A	9: 114,796,165	R66I	probably benign	Het
Cnbd1	A	G	4: 18,862,120	Y357H	probably damaging	Het
Col4a4	A	T	1: 82,529,602	V252E	unknown	Het
Col6a4	A	T	9: 106,071,979	M819K	probably benign	Het
Cwf19l2	T	C	9: 3,430,783	S372P	probably benign	Het
Daam2	A	T	17: 49,490,145	I204N	possibly damaging	Het
Dock6	T	C	9: 21,844,280	D216G	probably damaging	Het
Epha5	C	T	5: 84,105,891	D548N	possibly damaging	Het
Erich2	T	C	2: 70,534,292	Y311H	possibly damaging	Het
Gm3985	A	G	8: 32,890,477		noncoding transcript	Het
Gnb1	A	G	4: 155,543,067	T102A	possibly damaging	Het
Hcfc2	C	T	10: 82,709,146	A204V	probably null	Het
Hnrnpu	T	C	1: 178,333,894		probably benign	Het
Htt	A	G	5: 34,852,225	T1517A	probably damaging	Het
Klhl6	T	A	16: 19,957,139	D223V	probably damaging	Het
Kpna6	A	G	4: 129,657,779	S71P	possibly damaging	Het
Lama3	A	G	18: 12,441,131	D590G	probably benign	Het
Lipt1	T	G	1: 37,875,529	L222R	probably damaging	Het
Lrrc41	A	G	4: 116,093,177		probably benign	Het
Lrrc59	T	C	11: 94,634,672	V98A	probably benign	Het
Mast4	A	G	13: 102,774,184		probably null	Het
Mdc1	C	T	17: 35,850,394	S733F	probably benign	Het
Mknk1	C	T	4: 115,878,186		probably benign	Het
Mtmr7	A	G	8: 40,590,462	F141S	probably damaging	Het
Myo15b	A	G	11: 115,887,602	D1G	possibly damaging	Het
Odf3	T	C	7: 140,848,278	M1T	probably null	Het
Olfr1356	T	G	10: 78,847,575	L113F	probably damaging	Het
Phkb	T	A	8: 85,901,911	V183E	probably damaging	Het
Pola2	T	C	19: 5,953,864	Y161C	probably damaging	Het
Psen1	G	A	12: 83,731,778	V412I	probably benign	Het
Psmc4	C	A	7: 28,047,512	G77V	probably damaging	Het
Psmd3	A	G	11: 98,687,760	Y207C	probably damaging	Het
Pxk	T	A	14: 8,130,653	M84K	probably damaging	Het
Rab44	A	C	17: 29,136,337	Q19P	probably damaging	Het
Rbks	A	G	5: 31,624,515	Y314H	probably benign	Het
Rftn2	T	C	1: 55,214,240	D68G	possibly damaging	Het
Rims2	T	A	15: 39,535,914	S838R	probably damaging	Het
Sdc4	A	T	2: 164,431,218	D57E	probably damaging	Het
Slfn14	A	G	11: 83,279,156	L554P	probably damaging	Het
Spink2	G	T	5: 77,205,392	D83E	possibly damaging	Het
Srsf4	C	T	4: 131,900,102		probably benign	Het
Taar8b	A	T	10: 24,092,132	S55T	possibly damaging	Het
Tbca	A	G	13: 94,832,410	E35G	probably benign	Het
Tmc5	C	A	7: 118,628,829	H307Q	probably benign	Het
Tmem169	A	G	1: 72,298,152	D82G	probably benign	Het
Tmem72	T	C	6: 116,698,358	T58A	probably benign	Het
Ttc7	C	T	17: 87,334,321	P449S	probably damaging	Het
Ttf2	T	C	3: 100,961,406	E449G	probably benign	Het
Ubr4	C	A	4: 139,402,546	T659K	probably damaging	Het
Wdr1	A	G	5: 38,547,029	Y98H	probably damaging	Het
Wfikkn2	A	G	11: 94,239,052	Y88H	probably benign	Het
Zfp384	A	T	6: 125,030,848	H247L	probably damaging	Het
Zfp526	C	T	7: 25,225,870	A518V	probably damaging	Het
Zfp788	T	A	7: 41,647,568	H47Q	probably benign	Het

Other mutations in Blm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01531:Blm	APN	7	80474071	missense	probably damaging	1.00
IGL01658:Blm	APN	7	80463941	missense	probably damaging	0.98
IGL02048:Blm	APN	7	80502961	splice site	probably benign
IGL02060:Blm	APN	7	80514580	splice site	probably benign
IGL02063:Blm	APN	7	80509419	nonsense	probably null
IGL02102:Blm	APN	7	80469756	missense	probably damaging	1.00
IGL02420:Blm	APN	7	80496006	missense	probably damaging	1.00
IGL02452:Blm	APN	7	80503377	splice site	probably null
IGL02566:Blm	APN	7	80474196	missense	probably damaging	1.00
IGL03387:Blm	APN	7	80494147	missense	probably damaging	1.00
FR4304:Blm	UTSW	7	80463773	frame shift	probably null
FR4304:Blm	UTSW	7	80512919	small insertion	probably benign
FR4340:Blm	UTSW	7	80463767	unclassified	probably benign
FR4340:Blm	UTSW	7	80512907	small insertion	probably benign
FR4340:Blm	UTSW	7	80512910	small insertion	probably benign
FR4449:Blm	UTSW	7	80512908	small insertion	probably benign
FR4548:Blm	UTSW	7	80463769	frame shift	probably null
FR4589:Blm	UTSW	7	80463770	frame shift	probably null
FR4737:Blm	UTSW	7	80463771	frame shift	probably null
FR4737:Blm	UTSW	7	80463774	frame shift	probably null
FR4976:Blm	UTSW	7	80463767	unclassified	probably benign
FR4976:Blm	UTSW	7	80512907	small insertion	probably benign
R0133:Blm	UTSW	7	80502367	missense	possibly damaging	0.93
R0194:Blm	UTSW	7	80464946	unclassified	probably benign
R0526:Blm	UTSW	7	80505893	nonsense	probably null
R0673:Blm	UTSW	7	80499751	critical splice donor site	probably null
R0972:Blm	UTSW	7	80513370	missense	probably benign
R0980:Blm	UTSW	7	80499958	splice site	probably null
R1120:Blm	UTSW	7	80481466	missense	probably damaging	1.00
R1301:Blm	UTSW	7	80455417	nonsense	probably null
R1769:Blm	UTSW	7	80513370	missense	probably benign
R1866:Blm	UTSW	7	80494114	missense	probably benign	0.08
R1874:Blm	UTSW	7	80497418	missense	probably damaging	1.00
R1966:Blm	UTSW	7	80513186	missense	possibly damaging	0.86
R1991:Blm	UTSW	7	80505949	splice site	probably null
R2013:Blm	UTSW	7	80502399	missense	probably damaging	0.99
R2014:Blm	UTSW	7	80502399	missense	probably damaging	0.99
R2015:Blm	UTSW	7	80502399	missense	probably damaging	0.99
R2016:Blm	UTSW	7	80505926	missense	probably benign	0.26
R2103:Blm	UTSW	7	80505949	splice site	probably null
R2161:Blm	UTSW	7	80481370	splice site	probably null
R2215:Blm	UTSW	7	80499847	missense	possibly damaging	0.69
R3689:Blm	UTSW	7	80513079	missense	possibly damaging	0.56
R4049:Blm	UTSW	7	80502862	missense	probably benign	0.04
R4155:Blm	UTSW	7	80512904	small deletion	probably benign
R4695:Blm	UTSW	7	80494228	missense	probably damaging	1.00
R4774:Blm	UTSW	7	80463848	missense	probably damaging	1.00
R4835:Blm	UTSW	7	80509546	missense	probably benign	0.41
R4994:Blm	UTSW	7	80458825	missense	probably benign	0.00
R5039:Blm	UTSW	7	80505873	missense	possibly damaging	0.50
R5330:Blm	UTSW	7	80458936	missense	possibly damaging	0.73
R5375:Blm	UTSW	7	80513229	missense	probably benign	0.00
R5408:Blm	UTSW	7	80502622	missense	probably benign	0.01
R5574:Blm	UTSW	7	80499773	missense	probably damaging	1.00
R5606:Blm	UTSW	7	80460832	splice site	probably null
R5702:Blm	UTSW	7	80458927	missense	probably benign	0.13
R5809:Blm	UTSW	7	80464844	missense	probably damaging	1.00
R6114:Blm	UTSW	7	80513487	missense	probably damaging	1.00
R6157:Blm	UTSW	7	80512985	missense	probably benign	0.18
R6163:Blm	UTSW	7	80512904	small deletion	probably benign
R6254:Blm	UTSW	7	80480342	missense	probably benign	0.04
R6266:Blm	UTSW	7	80499940	missense	probably benign	0.03
R6364:Blm	UTSW	7	80494526	nonsense	probably null
R6446:Blm	UTSW	7	80512904	small deletion	probably benign
R6502:Blm	UTSW	7	80481475	missense	probably damaging	0.98
R6700:Blm	UTSW	7	80463850	missense	possibly damaging	0.91
R7002:Blm	UTSW	7	80469753	missense	probably benign	0.00
R7105:Blm	UTSW	7	80499768	missense	probably benign	0.44
R7320:Blm	UTSW	7	80455354	nonsense	probably null
R7465:Blm	UTSW	7	80513115	missense	probably benign	0.02
R7561:Blm	UTSW	7	80502528	missense	probably damaging	0.99
R8500:Blm	UTSW	7	80455284	missense	probably damaging	1.00
R8543:Blm	UTSW	7	80494216	missense	probably damaging	0.98
R8774-TAIL:Blm	UTSW	7	80512907	small insertion	probably benign
R8774-TAIL:Blm	UTSW	7	80512918	small insertion	probably benign
R8774-TAIL:Blm	UTSW	7	80512919	small insertion	probably benign
R8775-TAIL:Blm	UTSW	7	80512931	small insertion	probably benign
R8860:Blm	UTSW	7	80494528	missense	probably benign	0.30
R8928:Blm	UTSW	7	80512904	small deletion	probably benign
R9089:Blm	UTSW	7	80513119	missense	probably damaging	1.00
R9363:Blm	UTSW	7	80458915	missense	probably damaging	1.00
RF001:Blm	UTSW	7	80512903	small insertion	probably benign
RF001:Blm	UTSW	7	80512906	small insertion	probably benign
RF001:Blm	UTSW	7	80512927	small insertion	probably benign
RF002:Blm	UTSW	7	80512905	small insertion	probably benign
RF002:Blm	UTSW	7	80512927	small insertion	probably benign
RF007:Blm	UTSW	7	80512933	nonsense	probably null
RF016:Blm	UTSW	7	80512926	nonsense	probably null
RF018:Blm	UTSW	7	80512926	nonsense	probably null
RF027:Blm	UTSW	7	80512914	frame shift	probably null
RF028:Blm	UTSW	7	80512905	nonsense	probably null
RF031:Blm	UTSW	7	80512906	small insertion	probably benign
RF031:Blm	UTSW	7	80512923	small insertion	probably benign
RF032:Blm	UTSW	7	80512930	small insertion	probably benign
RF036:Blm	UTSW	7	80512914	nonsense	probably null
RF044:Blm	UTSW	7	80512930	small insertion	probably benign
RF053:Blm	UTSW	7	80512921	small insertion	probably benign
RF064:Blm	UTSW	7	80512923	nonsense	probably null
X0061:Blm	UTSW	7	80458850	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GCACTTATAACCACTTCCTTAGATG -3'
(R):5'- GCGTGGAAACGAATTCTAAGTTTTACC -3'

Sequencing Primer
(F):5'- GTGAATACACTGTAGCTGTCAGACAC -3'
(R):5'- TTACCATACCATTAAGCTCCAGTG -3'

Posted On

2016-03-01