Incidental Mutation 'R4833:Cwf19l2'
ID372994
Institutional Source Beutler Lab
Gene Symbol Cwf19l2
Ensembl Gene ENSMUSG00000025898
Gene NameCWF19-like 2, cell cycle control (S. pombe)
Synonyms3230401L03Rik
MMRRC Submission 042449-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.893) question?
Stock #R4833 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location3403592-3479236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3430783 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 372 (S372P)
Ref Sequence ENSEMBL: ENSMUSP00000027027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027027]
Predicted Effect probably benign
Transcript: ENSMUST00000027027
AA Change: S372P

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027027
Gene: ENSMUSG00000025898
AA Change: S372P

DomainStartEndE-ValueType
low complexity region 64 114 N/A INTRINSIC
coiled coil region 165 196 N/A INTRINSIC
low complexity region 403 418 N/A INTRINSIC
coiled coil region 496 524 N/A INTRINSIC
Pfam:CwfJ_C_1 655 779 1.8e-40 PFAM
Pfam:CwfJ_C_2 788 882 4.6e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212128
Meta Mutation Damage Score 0.0708 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C A 19: 3,716,872 T153K possibly damaging Het
4932438A13Rik A G 3: 36,964,968 I2007V probably damaging Het
Abca5 A C 11: 110,279,316 Y1318D probably benign Het
Adam18 A G 8: 24,674,101 I22T probably benign Het
Adgrv1 T A 13: 81,560,844 H1147L possibly damaging Het
Ankrd2 T C 19: 42,043,857 probably null Het
Bdkrb2 T C 12: 105,591,658 W53R probably benign Het
Blm T A 7: 80,466,826 I1111L probably benign Het
Bmp3 T G 5: 98,855,207 L32R probably damaging Het
Cdh23 T G 10: 60,385,038 E1312A probably damaging Het
Ceacam5 C T 7: 17,752,258 T560M probably benign Het
Cmtm8 C A 9: 114,796,165 R66I probably benign Het
Cnbd1 A G 4: 18,862,120 Y357H probably damaging Het
Col4a4 A T 1: 82,529,602 V252E unknown Het
Col6a4 A T 9: 106,071,979 M819K probably benign Het
Daam2 A T 17: 49,490,145 I204N possibly damaging Het
Dock6 T C 9: 21,844,280 D216G probably damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Erich2 T C 2: 70,534,292 Y311H possibly damaging Het
Gm3985 A G 8: 32,890,477 noncoding transcript Het
Gnb1 A G 4: 155,543,067 T102A possibly damaging Het
Hcfc2 C T 10: 82,709,146 A204V probably null Het
Hnrnpu T C 1: 178,333,894 probably benign Het
Htt A G 5: 34,852,225 T1517A probably damaging Het
Klhl6 T A 16: 19,957,139 D223V probably damaging Het
Kpna6 A G 4: 129,657,779 S71P possibly damaging Het
Lama3 A G 18: 12,441,131 D590G probably benign Het
Lipt1 T G 1: 37,875,529 L222R probably damaging Het
Lrrc41 A G 4: 116,093,177 probably benign Het
Lrrc59 T C 11: 94,634,672 V98A probably benign Het
Mast4 A G 13: 102,774,184 probably null Het
Mdc1 C T 17: 35,850,394 S733F probably benign Het
Mknk1 C T 4: 115,878,186 probably benign Het
Mtmr7 A G 8: 40,590,462 F141S probably damaging Het
Myo15b A G 11: 115,887,602 D1G possibly damaging Het
Odf3 T C 7: 140,848,278 M1T probably null Het
Olfr1356 T G 10: 78,847,575 L113F probably damaging Het
Phkb T A 8: 85,901,911 V183E probably damaging Het
Pola2 T C 19: 5,953,864 Y161C probably damaging Het
Psen1 G A 12: 83,731,778 V412I probably benign Het
Psmc4 C A 7: 28,047,512 G77V probably damaging Het
Psmd3 A G 11: 98,687,760 Y207C probably damaging Het
Pxk T A 14: 8,130,653 M84K probably damaging Het
Rab44 A C 17: 29,136,337 Q19P probably damaging Het
Rbks A G 5: 31,624,515 Y314H probably benign Het
Rftn2 T C 1: 55,214,240 D68G possibly damaging Het
Rims2 T A 15: 39,535,914 S838R probably damaging Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Slfn14 A G 11: 83,279,156 L554P probably damaging Het
Spink2 G T 5: 77,205,392 D83E possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Taar8b A T 10: 24,092,132 S55T possibly damaging Het
Tbca A G 13: 94,832,410 E35G probably benign Het
Tmc5 C A 7: 118,628,829 H307Q probably benign Het
Tmem169 A G 1: 72,298,152 D82G probably benign Het
Tmem72 T C 6: 116,698,358 T58A probably benign Het
Ttc7 C T 17: 87,334,321 P449S probably damaging Het
Ttf2 T C 3: 100,961,406 E449G probably benign Het
Ubr4 C A 4: 139,402,546 T659K probably damaging Het
Wdr1 A G 5: 38,547,029 Y98H probably damaging Het
Wfikkn2 A G 11: 94,239,052 Y88H probably benign Het
Zfp384 A T 6: 125,030,848 H247L probably damaging Het
Zfp526 C T 7: 25,225,870 A518V probably damaging Het
Zfp788 T A 7: 41,647,568 H47Q probably benign Het
Other mutations in Cwf19l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Cwf19l2 APN 9 3409990 missense probably benign 0.01
IGL00573:Cwf19l2 APN 9 3450161 splice site probably benign
IGL00757:Cwf19l2 APN 9 3460054 missense probably damaging 1.00
IGL00803:Cwf19l2 APN 9 3430810 missense probably benign 0.41
IGL01916:Cwf19l2 APN 9 3477869 missense possibly damaging 0.82
IGL02315:Cwf19l2 APN 9 3410030 missense probably damaging 1.00
IGL02419:Cwf19l2 APN 9 3418777 critical splice donor site probably null
IGL02427:Cwf19l2 APN 9 3456817 missense probably benign 0.00
IGL03026:Cwf19l2 APN 9 3428777 missense probably benign 0.28
IGL03028:Cwf19l2 APN 9 3430622 missense probably benign 0.26
IGL03199:Cwf19l2 APN 9 3477830 missense probably damaging 1.00
R0015:Cwf19l2 UTSW 9 3454666 missense probably benign 0.00
R0015:Cwf19l2 UTSW 9 3454666 missense probably benign 0.00
R0532:Cwf19l2 UTSW 9 3431057 missense probably benign 0.38
R0724:Cwf19l2 UTSW 9 3421377 critical splice donor site probably null
R0924:Cwf19l2 UTSW 9 3441047 splice site probably benign
R0947:Cwf19l2 UTSW 9 3421286 missense probably benign 0.16
R1210:Cwf19l2 UTSW 9 3430810 missense probably benign 0.00
R1393:Cwf19l2 UTSW 9 3456818 missense probably benign 0.01
R1541:Cwf19l2 UTSW 9 3456760 missense probably damaging 1.00
R1594:Cwf19l2 UTSW 9 3430973 missense probably benign
R1870:Cwf19l2 UTSW 9 3458802 missense possibly damaging 0.56
R1950:Cwf19l2 UTSW 9 3418674 missense probably benign
R1996:Cwf19l2 UTSW 9 3417947 missense probably benign 0.01
R2005:Cwf19l2 UTSW 9 3430720 missense possibly damaging 0.92
R2246:Cwf19l2 UTSW 9 3430661 missense probably benign 0.16
R2420:Cwf19l2 UTSW 9 3411341 missense possibly damaging 0.80
R3051:Cwf19l2 UTSW 9 3410006 missense probably benign 0.05
R3738:Cwf19l2 UTSW 9 3456803 missense probably benign 0.01
R3915:Cwf19l2 UTSW 9 3456776 missense probably damaging 1.00
R4034:Cwf19l2 UTSW 9 3456803 missense probably benign 0.01
R4035:Cwf19l2 UTSW 9 3456803 missense probably benign 0.01
R4323:Cwf19l2 UTSW 9 3430452 missense probably damaging 0.99
R4328:Cwf19l2 UTSW 9 3458878 missense probably damaging 1.00
R4329:Cwf19l2 UTSW 9 3458878 missense probably damaging 1.00
R4692:Cwf19l2 UTSW 9 3428709 missense probably damaging 1.00
R4775:Cwf19l2 UTSW 9 3430973 missense probably benign
R4779:Cwf19l2 UTSW 9 3410035 missense possibly damaging 0.95
R4822:Cwf19l2 UTSW 9 3458839 missense probably damaging 1.00
R5110:Cwf19l2 UTSW 9 3450012 critical splice acceptor site probably null
R5120:Cwf19l2 UTSW 9 3418761 nonsense probably null
R5164:Cwf19l2 UTSW 9 3475511 missense probably damaging 1.00
R5440:Cwf19l2 UTSW 9 3475549 missense probably damaging 1.00
R5567:Cwf19l2 UTSW 9 3456831 missense probably damaging 1.00
R5594:Cwf19l2 UTSW 9 3418773 missense probably benign 0.42
R5960:Cwf19l2 UTSW 9 3411404 missense probably benign 0.43
R6222:Cwf19l2 UTSW 9 3454569 nonsense probably null
R6259:Cwf19l2 UTSW 9 3458879 missense probably damaging 1.00
R6688:Cwf19l2 UTSW 9 3450015 missense probably benign 0.00
R6983:Cwf19l2 UTSW 9 3477817 missense probably damaging 1.00
R7063:Cwf19l2 UTSW 9 3430532 missense probably benign 0.03
R7506:Cwf19l2 UTSW 9 3456775 missense probably damaging 1.00
R7733:Cwf19l2 UTSW 9 3450066 missense probably benign 0.19
R7846:Cwf19l2 UTSW 9 3477889 missense probably damaging 1.00
R7900:Cwf19l2 UTSW 9 3460107 missense probably damaging 1.00
T0722:Cwf19l2 UTSW 9 3456755 missense probably benign 0.00
X0003:Cwf19l2 UTSW 9 3456755 missense probably benign 0.00
X0020:Cwf19l2 UTSW 9 3418662 missense probably damaging 1.00
Z1177:Cwf19l2 UTSW 9 3428782 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGCACATCAGACTTAGTG -3'
(R):5'- AGCTCCAGGTTTCCAATGGC -3'

Sequencing Primer
(F):5'- TCTCTCAGAGGACAGACACCTGG -3'
(R):5'- CCAATGGCTTTTTATCTGAAGGC -3'
Posted On2016-03-01