Incidental Mutation 'R4833:Olfr1356'
ID373001
Institutional Source Beutler Lab
Gene Symbol Olfr1356
Ensembl Gene ENSMUSG00000051190
Gene Nameolfactory receptor 1356
SynonymsMOR142-1, MOR142-2_p, GA_x6K02T2QGN0-2962025-2962987
MMRRC Submission 042449-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R4833 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78845052-78852166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 78847575 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 113 (L113F)
Ref Sequence ENSEMBL: ENSMUSP00000144815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061289] [ENSMUST00000205100]
Predicted Effect probably damaging
Transcript: ENSMUST00000061289
AA Change: L113F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054345
Gene: ENSMUSG00000051190
AA Change: L113F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.6e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.4e-5 PFAM
Pfam:7tm_1 41 290 6.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205100
AA Change: L113F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144815
Gene: ENSMUSG00000051190
AA Change: L113F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.6e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.4e-5 PFAM
Pfam:7tm_1 41 290 6.5e-22 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C A 19: 3,716,872 T153K possibly damaging Het
4932438A13Rik A G 3: 36,964,968 I2007V probably damaging Het
Abca5 A C 11: 110,279,316 Y1318D probably benign Het
Adam18 A G 8: 24,674,101 I22T probably benign Het
Adgrv1 T A 13: 81,560,844 H1147L possibly damaging Het
Ankrd2 T C 19: 42,043,857 probably null Het
Bdkrb2 T C 12: 105,591,658 W53R probably benign Het
Blm T A 7: 80,466,826 I1111L probably benign Het
Bmp3 T G 5: 98,855,207 L32R probably damaging Het
Cdh23 T G 10: 60,385,038 E1312A probably damaging Het
Ceacam5 C T 7: 17,752,258 T560M probably benign Het
Cmtm8 C A 9: 114,796,165 R66I probably benign Het
Cnbd1 A G 4: 18,862,120 Y357H probably damaging Het
Col4a4 A T 1: 82,529,602 V252E unknown Het
Col6a4 A T 9: 106,071,979 M819K probably benign Het
Cwf19l2 T C 9: 3,430,783 S372P probably benign Het
Daam2 A T 17: 49,490,145 I204N possibly damaging Het
Dock6 T C 9: 21,844,280 D216G probably damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Erich2 T C 2: 70,534,292 Y311H possibly damaging Het
Gm3985 A G 8: 32,890,477 noncoding transcript Het
Gnb1 A G 4: 155,543,067 T102A possibly damaging Het
Hcfc2 C T 10: 82,709,146 A204V probably null Het
Hnrnpu T C 1: 178,333,894 probably benign Het
Htt A G 5: 34,852,225 T1517A probably damaging Het
Klhl6 T A 16: 19,957,139 D223V probably damaging Het
Kpna6 A G 4: 129,657,779 S71P possibly damaging Het
Lama3 A G 18: 12,441,131 D590G probably benign Het
Lipt1 T G 1: 37,875,529 L222R probably damaging Het
Lrrc41 A G 4: 116,093,177 probably benign Het
Lrrc59 T C 11: 94,634,672 V98A probably benign Het
Mast4 A G 13: 102,774,184 probably null Het
Mdc1 C T 17: 35,850,394 S733F probably benign Het
Mknk1 C T 4: 115,878,186 probably benign Het
Mtmr7 A G 8: 40,590,462 F141S probably damaging Het
Myo15b A G 11: 115,887,602 D1G possibly damaging Het
Odf3 T C 7: 140,848,278 M1T probably null Het
Phkb T A 8: 85,901,911 V183E probably damaging Het
Pola2 T C 19: 5,953,864 Y161C probably damaging Het
Psen1 G A 12: 83,731,778 V412I probably benign Het
Psmc4 C A 7: 28,047,512 G77V probably damaging Het
Psmd3 A G 11: 98,687,760 Y207C probably damaging Het
Pxk T A 14: 8,130,653 M84K probably damaging Het
Rab44 A C 17: 29,136,337 Q19P probably damaging Het
Rbks A G 5: 31,624,515 Y314H probably benign Het
Rftn2 T C 1: 55,214,240 D68G possibly damaging Het
Rims2 T A 15: 39,535,914 S838R probably damaging Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Slfn14 A G 11: 83,279,156 L554P probably damaging Het
Spink2 G T 5: 77,205,392 D83E possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Taar8b A T 10: 24,092,132 S55T possibly damaging Het
Tbca A G 13: 94,832,410 E35G probably benign Het
Tmc5 C A 7: 118,628,829 H307Q probably benign Het
Tmem169 A G 1: 72,298,152 D82G probably benign Het
Tmem72 T C 6: 116,698,358 T58A probably benign Het
Ttc7 C T 17: 87,334,321 P449S probably damaging Het
Ttf2 T C 3: 100,961,406 E449G probably benign Het
Ubr4 C A 4: 139,402,546 T659K probably damaging Het
Wdr1 A G 5: 38,547,029 Y98H probably damaging Het
Wfikkn2 A G 11: 94,239,052 Y88H probably benign Het
Zfp384 A T 6: 125,030,848 H247L probably damaging Het
Zfp526 C T 7: 25,225,870 A518V probably damaging Het
Zfp788 T A 7: 41,647,568 H47Q probably benign Het
Other mutations in Olfr1356
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Olfr1356 APN 10 78847763 missense probably damaging 1.00
IGL01343:Olfr1356 APN 10 78847597 missense probably damaging 0.97
IGL01576:Olfr1356 APN 10 78847373 missense possibly damaging 0.94
IGL02314:Olfr1356 APN 10 78847265 missense probably damaging 1.00
IGL02474:Olfr1356 APN 10 78847063 missense probably damaging 1.00
IGL02960:Olfr1356 APN 10 78847537 missense probably damaging 1.00
IGL03049:Olfr1356 APN 10 78847522 missense possibly damaging 0.81
IGL03328:Olfr1356 APN 10 78847367 missense probably benign 0.39
R1602:Olfr1356 UTSW 10 78846968 missense probably benign
R1722:Olfr1356 UTSW 10 78846971 missense probably benign
R2178:Olfr1356 UTSW 10 78847778 missense probably damaging 0.96
R3903:Olfr1356 UTSW 10 78847298 missense probably benign 0.00
R3904:Olfr1356 UTSW 10 78847298 missense probably benign 0.00
R4241:Olfr1356 UTSW 10 78847905 missense probably benign 0.00
R5465:Olfr1356 UTSW 10 78847018 missense probably benign 0.00
R5527:Olfr1356 UTSW 10 78847775 missense probably benign 0.02
R5606:Olfr1356 UTSW 10 78847561 missense probably benign 0.19
R5977:Olfr1356 UTSW 10 78847738 missense possibly damaging 0.95
R6219:Olfr1356 UTSW 10 78847259 missense possibly damaging 0.88
R6996:Olfr1356 UTSW 10 78847517 missense probably benign 0.00
R7136:Olfr1356 UTSW 10 78847781 missense probably benign 0.43
R7782:Olfr1356 UTSW 10 78847613 missense probably benign 0.01
R7996:Olfr1356 UTSW 10 78847321 missense probably damaging 1.00
Z1176:Olfr1356 UTSW 10 78847021 missense possibly damaging 0.73
Z1177:Olfr1356 UTSW 10 78847456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTTCGGGAAGATCACAG -3'
(R):5'- TTGTGGCCATCATATCTGACCC -3'

Sequencing Primer
(F):5'- GGAATTTCCATGTTTGTACAGAAGG -3'
(R):5'- ATCATATCTGACCCCCACCTG -3'
Posted On2016-03-01