Incidental Mutation 'R4833:Hcfc2'
ID 373002
Institutional Source Beutler Lab
Gene Symbol Hcfc2
Ensembl Gene ENSMUSG00000020246
Gene Name host cell factor C2
Synonyms 1700129L13Rik
MMRRC Submission 042449-MU
Accession Numbers

Genbank: NM_001081218; MGI: 1915183

Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock # R4833 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 82696160-82742428 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 82709146 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 204 (A204V)
Ref Sequence ENSEMBL: ENSMUSP00000020478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020478]
AlphaFold Q9D968
Predicted Effect probably null
Transcript: ENSMUST00000020478
AA Change: A204V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000020478
Gene: ENSMUSG00000020246
AA Change: A204V

DomainStartEndE-ValueType
Pfam:Kelch_1 22 60 2.1e-6 PFAM
Pfam:Kelch_5 68 106 1.1e-6 PFAM
Pfam:Kelch_3 81 135 8.8e-7 PFAM
Pfam:Kelch_5 186 230 8.4e-7 PFAM
Pfam:Kelch_3 206 253 1.6e-11 PFAM
Pfam:Kelch_1 244 302 7.5e-9 PFAM
Pfam:Kelch_3 254 323 3.4e-7 PFAM
Pfam:Kelch_5 312 356 1.4e-6 PFAM
FN3 357 591 8.43e-9 SMART
FN3 607 703 6.06e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160845
Predicted Effect probably benign
Transcript: ENSMUST00000162422
SMART Domains Protein: ENSMUSP00000124472
Gene: ENSMUSG00000020246

DomainStartEndE-ValueType
Pfam:Kelch_1 1 38 8.5e-7 PFAM
Pfam:Kelch_5 46 84 3.7e-8 PFAM
Pfam:Kelch_3 59 113 2.6e-8 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two proteins which interact with VP16, a herpes simplex virus protein that initiates virus infection. Both the encoded protein and the original Herpes host cell factor interact with VP16 through a beta-propeller domain. The original Herpes host cell factor, however, is effective at initiating viral infection while the encoded protein is not. Transcripts of varying length due to alternative polyadenylation signals have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null or severely hypomorphic allele exhibit reduced poly(I:C)-mediated TLR3 signaling and increased mortality following viral infection. [provided by MGI curators]
Allele List at MGI

none known

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C A 19: 3,716,872 T153K possibly damaging Het
4932438A13Rik A G 3: 36,964,968 I2007V probably damaging Het
Abca5 A C 11: 110,279,316 Y1318D probably benign Het
Adam18 A G 8: 24,674,101 I22T probably benign Het
Adgrv1 T A 13: 81,560,844 H1147L possibly damaging Het
Ankrd2 T C 19: 42,043,857 probably null Het
Bdkrb2 T C 12: 105,591,658 W53R probably benign Het
Blm T A 7: 80,466,826 I1111L probably benign Het
Bmp3 T G 5: 98,855,207 L32R probably damaging Het
Cdh23 T G 10: 60,385,038 E1312A probably damaging Het
Ceacam5 C T 7: 17,752,258 T560M probably benign Het
Cmtm8 C A 9: 114,796,165 R66I probably benign Het
Cnbd1 A G 4: 18,862,120 Y357H probably damaging Het
Col4a4 A T 1: 82,529,602 V252E unknown Het
Col6a4 A T 9: 106,071,979 M819K probably benign Het
Cwf19l2 T C 9: 3,430,783 S372P probably benign Het
Daam2 A T 17: 49,490,145 I204N possibly damaging Het
Dock6 T C 9: 21,844,280 D216G probably damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Erich2 T C 2: 70,534,292 Y311H possibly damaging Het
Gm3985 A G 8: 32,890,477 noncoding transcript Het
Gnb1 A G 4: 155,543,067 T102A possibly damaging Het
Hnrnpu T C 1: 178,333,894 probably benign Het
Htt A G 5: 34,852,225 T1517A probably damaging Het
Klhl6 T A 16: 19,957,139 D223V probably damaging Het
Kpna6 A G 4: 129,657,779 S71P possibly damaging Het
Lama3 A G 18: 12,441,131 D590G probably benign Het
Lipt1 T G 1: 37,875,529 L222R probably damaging Het
Lrrc41 A G 4: 116,093,177 probably benign Het
Lrrc59 T C 11: 94,634,672 V98A probably benign Het
Mast4 A G 13: 102,774,184 probably null Het
Mdc1 C T 17: 35,850,394 S733F probably benign Het
Mknk1 C T 4: 115,878,186 probably benign Het
Mtmr7 A G 8: 40,590,462 F141S probably damaging Het
Myo15b A G 11: 115,887,602 D1G possibly damaging Het
Odf3 T C 7: 140,848,278 M1T probably null Het
Olfr1356 T G 10: 78,847,575 L113F probably damaging Het
Phkb T A 8: 85,901,911 V183E probably damaging Het
Pola2 T C 19: 5,953,864 Y161C probably damaging Het
Psen1 G A 12: 83,731,778 V412I probably benign Het
Psmc4 C A 7: 28,047,512 G77V probably damaging Het
Psmd3 A G 11: 98,687,760 Y207C probably damaging Het
Pxk T A 14: 8,130,653 M84K probably damaging Het
Rab44 A C 17: 29,136,337 Q19P probably damaging Het
Rbks A G 5: 31,624,515 Y314H probably benign Het
Rftn2 T C 1: 55,214,240 D68G possibly damaging Het
Rims2 T A 15: 39,535,914 S838R probably damaging Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Slfn14 A G 11: 83,279,156 L554P probably damaging Het
Spink2 G T 5: 77,205,392 D83E possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Taar8b A T 10: 24,092,132 S55T possibly damaging Het
Tbca A G 13: 94,832,410 E35G probably benign Het
Tmc5 C A 7: 118,628,829 H307Q probably benign Het
Tmem169 A G 1: 72,298,152 D82G probably benign Het
Tmem72 T C 6: 116,698,358 T58A probably benign Het
Ttc7 C T 17: 87,334,321 P449S probably damaging Het
Ttf2 T C 3: 100,961,406 E449G probably benign Het
Ubr4 C A 4: 139,402,546 T659K probably damaging Het
Wdr1 A G 5: 38,547,029 Y98H probably damaging Het
Wfikkn2 A G 11: 94,239,052 Y88H probably benign Het
Zfp384 A T 6: 125,030,848 H247L probably damaging Het
Zfp526 C T 7: 25,225,870 A518V probably damaging Het
Zfp788 T A 7: 41,647,568 H47Q probably benign Het
Other mutations in Hcfc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Hcfc2 APN 10 82741278 splice site probably null
IGL01799:Hcfc2 APN 10 82700991 missense probably damaging 1.00
IGL01916:Hcfc2 APN 10 82734383 missense possibly damaging 0.94
IGL02150:Hcfc2 APN 10 82710018 missense probably damaging 1.00
IGL02378:Hcfc2 APN 10 82709071 missense possibly damaging 0.64
IGL02580:Hcfc2 APN 10 82728422 missense probably benign 0.00
IGL02641:Hcfc2 APN 10 82702549 missense probably damaging 1.00
Backstabbing UTSW 10 82711825 splice site probably null
feckless UTSW 10 82712061 missense probably damaging 1.00
Minions UTSW 10 82739245 missense probably damaging 1.00
scaffold UTSW 10 82738408 missense probably damaging 1.00
R0380:Hcfc2 UTSW 10 82728438 splice site probably benign
R0528:Hcfc2 UTSW 10 82739245 missense probably damaging 1.00
R0534:Hcfc2 UTSW 10 82738408 missense probably damaging 1.00
R1646:Hcfc2 UTSW 10 82701027 missense probably damaging 1.00
R1903:Hcfc2 UTSW 10 82702558 missense probably damaging 0.98
R1939:Hcfc2 UTSW 10 82702450 missense probably damaging 0.99
R2014:Hcfc2 UTSW 10 82738980 missense probably benign 0.23
R2015:Hcfc2 UTSW 10 82738980 missense probably benign 0.23
R2571:Hcfc2 UTSW 10 82709023 missense probably damaging 1.00
R4540:Hcfc2 UTSW 10 82732647 missense probably benign 0.10
R4694:Hcfc2 UTSW 10 82723700 missense probably damaging 1.00
R4735:Hcfc2 UTSW 10 82712080 missense probably damaging 1.00
R6837:Hcfc2 UTSW 10 82739196 missense probably damaging 0.96
R7268:Hcfc2 UTSW 10 82709012 nonsense probably null
R7683:Hcfc2 UTSW 10 82699229 missense probably benign 0.00
R7733:Hcfc2 UTSW 10 82739179 missense probably benign 0.00
R7742:Hcfc2 UTSW 10 82711825 splice site probably null
R8319:Hcfc2 UTSW 10 82738367 missense probably damaging 0.98
R8829:Hcfc2 UTSW 10 82738345 missense probably damaging 1.00
R8989:Hcfc2 UTSW 10 82700988 missense probably damaging 1.00
R9189:Hcfc2 UTSW 10 82699207 missense probably benign 0.06
R9241:Hcfc2 UTSW 10 82732651 missense probably benign
R9362:Hcfc2 UTSW 10 82738424 missense probably damaging 1.00
R9363:Hcfc2 UTSW 10 82738424 missense probably damaging 1.00
R9386:Hcfc2 UTSW 10 82739103 missense probably damaging 1.00
V3553:Hcfc2 UTSW 10 82712061 missense probably damaging 1.00
X0022:Hcfc2 UTSW 10 82709967 missense probably damaging 0.99
Z1176:Hcfc2 UTSW 10 82699172 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTTCTTTTCAAAACCCTGTGTGT -3'
(R):5'- TGCTGACTAAAATCTTAGTGCAATTTG -3'

Sequencing Primer
(F):5'- TGAGATTACAGCTGTGCACC -3'
(R):5'- GATTACCTAAATCAAGCTGCC -3'
Posted On 2016-03-01