Mutagenetix > Incidental Mutations

Incidental Mutation 'R4833:Hcfc2'

373002

Institutional Source

Beutler Lab

Gene Symbol

Hcfc2

Ensembl Gene

ENSMUSG00000020246

Gene Name

host cell factor C2

Synonyms

1700129L13Rik

MMRRC Submission

042449-MU

Accession Numbers

Genbank: NM_001081218; MGI: 1915183

Is this an essential gene?

Probably non essential (E-score: 0.222) question?

Stock #

R4833 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82696160-82742428 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 82709146 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 204 (A204V)

Ref Sequence

ENSEMBL: ENSMUSP00000020478 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020478]

AlphaFold

Q9D968

Predicted Effect

probably null
Transcript: ENSMUST00000020478
AA Change: A204V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000020478
Gene: ENSMUSG00000020246
AA Change: A204V

Domain	Start	End	E-Value	Type
Pfam:Kelch_1	22	60	2.1e-6	PFAM
Pfam:Kelch_5	68	106	1.1e-6	PFAM
Pfam:Kelch_3	81	135	8.8e-7	PFAM
Pfam:Kelch_5	186	230	8.4e-7	PFAM
Pfam:Kelch_3	206	253	1.6e-11	PFAM
Pfam:Kelch_1	244	302	7.5e-9	PFAM
Pfam:Kelch_3	254	323	3.4e-7	PFAM
Pfam:Kelch_5	312	356	1.4e-6	PFAM
FN3	357	591	8.43e-9	SMART
FN3	607	703	6.06e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160845

Predicted Effect

probably benign
Transcript: ENSMUST00000162422

SMART Domains

Protein: ENSMUSP00000124472
Gene: ENSMUSG00000020246

Domain	Start	End	E-Value	Type
Pfam:Kelch_1	1	38	8.5e-7	PFAM
Pfam:Kelch_5	46	84	3.7e-8	PFAM
Pfam:Kelch_3	59	113	2.6e-8	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two proteins which interact with VP16, a herpes simplex virus protein that initiates virus infection. Both the encoded protein and the original Herpes host cell factor interact with VP16 through a beta-propeller domain. The original Herpes host cell factor, however, is effective at initiating viral infection while the encoded protein is not. Transcripts of varying length due to alternative polyadenylation signals have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null or severely hypomorphic allele exhibit reduced poly(I:C)-mediated TLR3 signaling and increased mortality following viral infection. [provided by MGI curators]

Allele List at MGI

none known

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	C	A	19: 3,716,872	T153K	possibly damaging	Het
4932438A13Rik	A	G	3: 36,964,968	I2007V	probably damaging	Het
Abca5	A	C	11: 110,279,316	Y1318D	probably benign	Het
Adam18	A	G	8: 24,674,101	I22T	probably benign	Het
Adgrv1	T	A	13: 81,560,844	H1147L	possibly damaging	Het
Ankrd2	T	C	19: 42,043,857		probably null	Het
Bdkrb2	T	C	12: 105,591,658	W53R	probably benign	Het
Blm	T	A	7: 80,466,826	I1111L	probably benign	Het
Bmp3	T	G	5: 98,855,207	L32R	probably damaging	Het
Cdh23	T	G	10: 60,385,038	E1312A	probably damaging	Het
Ceacam5	C	T	7: 17,752,258	T560M	probably benign	Het
Cmtm8	C	A	9: 114,796,165	R66I	probably benign	Het
Cnbd1	A	G	4: 18,862,120	Y357H	probably damaging	Het
Col4a4	A	T	1: 82,529,602	V252E	unknown	Het
Col6a4	A	T	9: 106,071,979	M819K	probably benign	Het
Cwf19l2	T	C	9: 3,430,783	S372P	probably benign	Het
Daam2	A	T	17: 49,490,145	I204N	possibly damaging	Het
Dock6	T	C	9: 21,844,280	D216G	probably damaging	Het
Epha5	C	T	5: 84,105,891	D548N	possibly damaging	Het
Erich2	T	C	2: 70,534,292	Y311H	possibly damaging	Het
Gm3985	A	G	8: 32,890,477		noncoding transcript	Het
Gnb1	A	G	4: 155,543,067	T102A	possibly damaging	Het
Hnrnpu	T	C	1: 178,333,894		probably benign	Het
Htt	A	G	5: 34,852,225	T1517A	probably damaging	Het
Klhl6	T	A	16: 19,957,139	D223V	probably damaging	Het
Kpna6	A	G	4: 129,657,779	S71P	possibly damaging	Het
Lama3	A	G	18: 12,441,131	D590G	probably benign	Het
Lipt1	T	G	1: 37,875,529	L222R	probably damaging	Het
Lrrc41	A	G	4: 116,093,177		probably benign	Het
Lrrc59	T	C	11: 94,634,672	V98A	probably benign	Het
Mast4	A	G	13: 102,774,184		probably null	Het
Mdc1	C	T	17: 35,850,394	S733F	probably benign	Het
Mknk1	C	T	4: 115,878,186		probably benign	Het
Mtmr7	A	G	8: 40,590,462	F141S	probably damaging	Het
Myo15b	A	G	11: 115,887,602	D1G	possibly damaging	Het
Odf3	T	C	7: 140,848,278	M1T	probably null	Het
Olfr1356	T	G	10: 78,847,575	L113F	probably damaging	Het
Phkb	T	A	8: 85,901,911	V183E	probably damaging	Het
Pola2	T	C	19: 5,953,864	Y161C	probably damaging	Het
Psen1	G	A	12: 83,731,778	V412I	probably benign	Het
Psmc4	C	A	7: 28,047,512	G77V	probably damaging	Het
Psmd3	A	G	11: 98,687,760	Y207C	probably damaging	Het
Pxk	T	A	14: 8,130,653	M84K	probably damaging	Het
Rab44	A	C	17: 29,136,337	Q19P	probably damaging	Het
Rbks	A	G	5: 31,624,515	Y314H	probably benign	Het
Rftn2	T	C	1: 55,214,240	D68G	possibly damaging	Het
Rims2	T	A	15: 39,535,914	S838R	probably damaging	Het
Sdc4	A	T	2: 164,431,218	D57E	probably damaging	Het
Slfn14	A	G	11: 83,279,156	L554P	probably damaging	Het
Spink2	G	T	5: 77,205,392	D83E	possibly damaging	Het
Srsf4	C	T	4: 131,900,102		probably benign	Het
Taar8b	A	T	10: 24,092,132	S55T	possibly damaging	Het
Tbca	A	G	13: 94,832,410	E35G	probably benign	Het
Tmc5	C	A	7: 118,628,829	H307Q	probably benign	Het
Tmem169	A	G	1: 72,298,152	D82G	probably benign	Het
Tmem72	T	C	6: 116,698,358	T58A	probably benign	Het
Ttc7	C	T	17: 87,334,321	P449S	probably damaging	Het
Ttf2	T	C	3: 100,961,406	E449G	probably benign	Het
Ubr4	C	A	4: 139,402,546	T659K	probably damaging	Het
Wdr1	A	G	5: 38,547,029	Y98H	probably damaging	Het
Wfikkn2	A	G	11: 94,239,052	Y88H	probably benign	Het
Zfp384	A	T	6: 125,030,848	H247L	probably damaging	Het
Zfp526	C	T	7: 25,225,870	A518V	probably damaging	Het
Zfp788	T	A	7: 41,647,568	H47Q	probably benign	Het

Other mutations in Hcfc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00847:Hcfc2	APN	10	82741278	splice site	probably null
IGL01799:Hcfc2	APN	10	82700991	missense	probably damaging	1.00
IGL01916:Hcfc2	APN	10	82734383	missense	possibly damaging	0.94
IGL02150:Hcfc2	APN	10	82710018	missense	probably damaging	1.00
IGL02378:Hcfc2	APN	10	82709071	missense	possibly damaging	0.64
IGL02580:Hcfc2	APN	10	82728422	missense	probably benign	0.00
IGL02641:Hcfc2	APN	10	82702549	missense	probably damaging	1.00
Backstabbing	UTSW	10	82711825	splice site	probably null
feckless	UTSW	10	82712061	missense	probably damaging	1.00
Minions	UTSW	10	82739245	missense	probably damaging	1.00
scaffold	UTSW	10	82738408	missense	probably damaging	1.00
R0380:Hcfc2	UTSW	10	82728438	splice site	probably benign
R0528:Hcfc2	UTSW	10	82739245	missense	probably damaging	1.00
R0534:Hcfc2	UTSW	10	82738408	missense	probably damaging	1.00
R1646:Hcfc2	UTSW	10	82701027	missense	probably damaging	1.00
R1903:Hcfc2	UTSW	10	82702558	missense	probably damaging	0.98
R1939:Hcfc2	UTSW	10	82702450	missense	probably damaging	0.99
R2014:Hcfc2	UTSW	10	82738980	missense	probably benign	0.23
R2015:Hcfc2	UTSW	10	82738980	missense	probably benign	0.23
R2571:Hcfc2	UTSW	10	82709023	missense	probably damaging	1.00
R4540:Hcfc2	UTSW	10	82732647	missense	probably benign	0.10
R4694:Hcfc2	UTSW	10	82723700	missense	probably damaging	1.00
R4735:Hcfc2	UTSW	10	82712080	missense	probably damaging	1.00
R6837:Hcfc2	UTSW	10	82739196	missense	probably damaging	0.96
R7268:Hcfc2	UTSW	10	82709012	nonsense	probably null
R7683:Hcfc2	UTSW	10	82699229	missense	probably benign	0.00
R7733:Hcfc2	UTSW	10	82739179	missense	probably benign	0.00
R7742:Hcfc2	UTSW	10	82711825	splice site	probably null
R8319:Hcfc2	UTSW	10	82738367	missense	probably damaging	0.98
R8829:Hcfc2	UTSW	10	82738345	missense	probably damaging	1.00
R8989:Hcfc2	UTSW	10	82700988	missense	probably damaging	1.00
R9189:Hcfc2	UTSW	10	82699207	missense	probably benign	0.06
R9241:Hcfc2	UTSW	10	82732651	missense	probably benign
R9362:Hcfc2	UTSW	10	82738424	missense	probably damaging	1.00
R9363:Hcfc2	UTSW	10	82738424	missense	probably damaging	1.00
R9386:Hcfc2	UTSW	10	82739103	missense	probably damaging	1.00
V3553:Hcfc2	UTSW	10	82712061	missense	probably damaging	1.00
X0022:Hcfc2	UTSW	10	82709967	missense	probably damaging	0.99
Z1176:Hcfc2	UTSW	10	82699172	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TTTCTTTTCAAAACCCTGTGTGT -3'
(R):5'- TGCTGACTAAAATCTTAGTGCAATTTG -3'

Sequencing Primer
(F):5'- TGAGATTACAGCTGTGCACC -3'
(R):5'- GATTACCTAAATCAAGCTGCC -3'

Posted On

2016-03-01