Incidental Mutation 'R4833:Psmd3'
ID373008
Institutional Source Beutler Lab
Gene Symbol Psmd3
Ensembl Gene ENSMUSG00000017221
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 3
SynonymsPsd3, AntP91a, Tstap91a
MMRRC Submission 042449-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R4833 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98682554-98695979 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98687760 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 207 (Y207C)
Ref Sequence ENSEMBL: ENSMUSP00000017365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017365]
Predicted Effect probably damaging
Transcript: ENSMUST00000017365
AA Change: Y207C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017365
Gene: ENSMUSG00000017221
AA Change: Y207C

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
low complexity region 37 51 N/A INTRINSIC
PAM 217 389 1.07e-68 SMART
PINT 389 479 3.26e-27 SMART
coiled coil region 495 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122854
Predicted Effect probably benign
Transcript: ENSMUST00000123676
SMART Domains Protein: ENSMUSP00000116968
Gene: ENSMUSG00000017221

DomainStartEndE-ValueType
PAM 2 198 2.1e-62 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152102
Meta Mutation Damage Score 0.9681 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the proteasome subunit S3 family that functions as one of the non-ATPase subunits of the 19S regulator lid. Single nucleotide polymorphisms in this gene are associated with neutrophil count. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C A 19: 3,716,872 T153K possibly damaging Het
4932438A13Rik A G 3: 36,964,968 I2007V probably damaging Het
Abca5 A C 11: 110,279,316 Y1318D probably benign Het
Adam18 A G 8: 24,674,101 I22T probably benign Het
Adgrv1 T A 13: 81,560,844 H1147L possibly damaging Het
Ankrd2 T C 19: 42,043,857 probably null Het
Bdkrb2 T C 12: 105,591,658 W53R probably benign Het
Blm T A 7: 80,466,826 I1111L probably benign Het
Bmp3 T G 5: 98,855,207 L32R probably damaging Het
Cdh23 T G 10: 60,385,038 E1312A probably damaging Het
Ceacam5 C T 7: 17,752,258 T560M probably benign Het
Cmtm8 C A 9: 114,796,165 R66I probably benign Het
Cnbd1 A G 4: 18,862,120 Y357H probably damaging Het
Col4a4 A T 1: 82,529,602 V252E unknown Het
Col6a4 A T 9: 106,071,979 M819K probably benign Het
Cwf19l2 T C 9: 3,430,783 S372P probably benign Het
Daam2 A T 17: 49,490,145 I204N possibly damaging Het
Dock6 T C 9: 21,844,280 D216G probably damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Erich2 T C 2: 70,534,292 Y311H possibly damaging Het
Gm3985 A G 8: 32,890,477 noncoding transcript Het
Gnb1 A G 4: 155,543,067 T102A possibly damaging Het
Hcfc2 C T 10: 82,709,146 A204V probably null Het
Hnrnpu T C 1: 178,333,894 probably benign Het
Htt A G 5: 34,852,225 T1517A probably damaging Het
Klhl6 T A 16: 19,957,139 D223V probably damaging Het
Kpna6 A G 4: 129,657,779 S71P possibly damaging Het
Lama3 A G 18: 12,441,131 D590G probably benign Het
Lipt1 T G 1: 37,875,529 L222R probably damaging Het
Lrrc41 A G 4: 116,093,177 probably benign Het
Lrrc59 T C 11: 94,634,672 V98A probably benign Het
Mast4 A G 13: 102,774,184 probably null Het
Mdc1 C T 17: 35,850,394 S733F probably benign Het
Mknk1 C T 4: 115,878,186 probably benign Het
Mtmr7 A G 8: 40,590,462 F141S probably damaging Het
Myo15b A G 11: 115,887,602 D1G possibly damaging Het
Odf3 T C 7: 140,848,278 M1T probably null Het
Olfr1356 T G 10: 78,847,575 L113F probably damaging Het
Phkb T A 8: 85,901,911 V183E probably damaging Het
Pola2 T C 19: 5,953,864 Y161C probably damaging Het
Psen1 G A 12: 83,731,778 V412I probably benign Het
Psmc4 C A 7: 28,047,512 G77V probably damaging Het
Pxk T A 14: 8,130,653 M84K probably damaging Het
Rab44 A C 17: 29,136,337 Q19P probably damaging Het
Rbks A G 5: 31,624,515 Y314H probably benign Het
Rftn2 T C 1: 55,214,240 D68G possibly damaging Het
Rims2 T A 15: 39,535,914 S838R probably damaging Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Slfn14 A G 11: 83,279,156 L554P probably damaging Het
Spink2 G T 5: 77,205,392 D83E possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Taar8b A T 10: 24,092,132 S55T possibly damaging Het
Tbca A G 13: 94,832,410 E35G probably benign Het
Tmc5 C A 7: 118,628,829 H307Q probably benign Het
Tmem169 A G 1: 72,298,152 D82G probably benign Het
Tmem72 T C 6: 116,698,358 T58A probably benign Het
Ttc7 C T 17: 87,334,321 P449S probably damaging Het
Ttf2 T C 3: 100,961,406 E449G probably benign Het
Ubr4 C A 4: 139,402,546 T659K probably damaging Het
Wdr1 A G 5: 38,547,029 Y98H probably damaging Het
Wfikkn2 A G 11: 94,239,052 Y88H probably benign Het
Zfp384 A T 6: 125,030,848 H247L probably damaging Het
Zfp526 C T 7: 25,225,870 A518V probably damaging Het
Zfp788 T A 7: 41,647,568 H47Q probably benign Het
Other mutations in Psmd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Psmd3 APN 11 98685568 missense probably benign 0.06
IGL01353:Psmd3 APN 11 98690600 missense probably benign 0.05
R1368:Psmd3 UTSW 11 98682920 missense probably damaging 1.00
R1563:Psmd3 UTSW 11 98694225 missense probably damaging 1.00
R2258:Psmd3 UTSW 11 98690964 missense probably benign 0.18
R2259:Psmd3 UTSW 11 98690964 missense probably benign 0.18
R3606:Psmd3 UTSW 11 98690954 missense probably damaging 1.00
R3607:Psmd3 UTSW 11 98690954 missense probably damaging 1.00
R4616:Psmd3 UTSW 11 98682926 missense probably benign 0.00
R5033:Psmd3 UTSW 11 98682824 missense probably damaging 1.00
R5585:Psmd3 UTSW 11 98682881 missense possibly damaging 0.45
R5687:Psmd3 UTSW 11 98693669 missense probably damaging 1.00
R5929:Psmd3 UTSW 11 98695596 missense probably damaging 1.00
R6028:Psmd3 UTSW 11 98685665 missense probably damaging 0.99
R6240:Psmd3 UTSW 11 98693653 missense probably damaging 0.98
R6449:Psmd3 UTSW 11 98685640 missense probably benign
R6956:Psmd3 UTSW 11 98695551 missense probably damaging 1.00
R7009:Psmd3 UTSW 11 98682766 missense probably benign 0.04
R7051:Psmd3 UTSW 11 98682833 missense possibly damaging 0.68
R7401:Psmd3 UTSW 11 98685640 missense probably benign
R7449:Psmd3 UTSW 11 98695551 missense probably damaging 1.00
R7549:Psmd3 UTSW 11 98690961 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- ATTCTTCAGCTACCAAGAAATACTG -3'
(R):5'- TGCCACTCCCTCAGCACAG -3'

Sequencing Primer
(F):5'- CTCTTGGATATGCACCTAGGAACAG -3'
(R):5'- AGCCTGAACAAGTTGTCTCG -3'
Posted On2016-03-01