Mutagenetix > Incidental Mutations

Incidental Mutation 'R4833:Abca5'

373009

Institutional Source

Beutler Lab

Gene Symbol

Abca5

Ensembl Gene

ENSMUSG00000018800

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 5

Synonyms

ABC13, B930033A02Rik

MMRRC Submission

042449-MU

Accession Numbers

NCBI RefSeq: NM_147219.2; MGI: 2386607

Is this an essential gene?

Probably non essential (E-score: 0.119) question?

Stock #

R4833 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110269369-110337716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 110279316 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Aspartic acid at position 1318 (Y1318D)

Ref Sequence

ENSEMBL: ENSMUSP00000047927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043961]

AlphaFold

Q8K448

Predicted Effect

probably benign
Transcript: ENSMUST00000043961
AA Change: Y1318D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000047927
Gene: ENSMUSG00000018800
AA Change: Y1318D

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	29	416	4.3e-33	PFAM
AAA	506	691	2.88e-8	SMART
low complexity region	733	744	N/A	INTRINSIC
transmembrane domain	864	886	N/A	INTRINSIC
transmembrane domain	971	993	N/A	INTRINSIC
low complexity region	1262	1267	N/A	INTRINSIC
AAA	1325	1512	3.52e-3	SMART

Meta Mutation Damage Score

0.0943

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

99% (74/75)

MGI Phenotype

Strain: 3581814
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24, but neither the substrate nor the function of this gene is known. Alternative splicing of this gene results in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit exophthalmos, tremors and collapse of the thyroid gland, and develop a dilated cardiomyopathy with large thrombi due to depression of the cardiac function. Severe edema, liver injury and premature death appear to be sensitive to genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	C	A	19: 3,716,872	T153K	possibly damaging	Het
4932438A13Rik	A	G	3: 36,964,968	I2007V	probably damaging	Het
Adam18	A	G	8: 24,674,101	I22T	probably benign	Het
Adgrv1	T	A	13: 81,560,844	H1147L	possibly damaging	Het
Ankrd2	T	C	19: 42,043,857		probably null	Het
Bdkrb2	T	C	12: 105,591,658	W53R	probably benign	Het
Blm	T	A	7: 80,466,826	I1111L	probably benign	Het
Bmp3	T	G	5: 98,855,207	L32R	probably damaging	Het
Cdh23	T	G	10: 60,385,038	E1312A	probably damaging	Het
Ceacam5	C	T	7: 17,752,258	T560M	probably benign	Het
Cmtm8	C	A	9: 114,796,165	R66I	probably benign	Het
Cnbd1	A	G	4: 18,862,120	Y357H	probably damaging	Het
Col4a4	A	T	1: 82,529,602	V252E	unknown	Het
Col6a4	A	T	9: 106,071,979	M819K	probably benign	Het
Cwf19l2	T	C	9: 3,430,783	S372P	probably benign	Het
Daam2	A	T	17: 49,490,145	I204N	possibly damaging	Het
Dock6	T	C	9: 21,844,280	D216G	probably damaging	Het
Epha5	C	T	5: 84,105,891	D548N	possibly damaging	Het
Erich2	T	C	2: 70,534,292	Y311H	possibly damaging	Het
Gm3985	A	G	8: 32,890,477		noncoding transcript	Het
Gnb1	A	G	4: 155,543,067	T102A	possibly damaging	Het
Hcfc2	C	T	10: 82,709,146	A204V	probably null	Het
Hnrnpu	T	C	1: 178,333,894		probably benign	Het
Htt	A	G	5: 34,852,225	T1517A	probably damaging	Het
Klhl6	T	A	16: 19,957,139	D223V	probably damaging	Het
Kpna6	A	G	4: 129,657,779	S71P	possibly damaging	Het
Lama3	A	G	18: 12,441,131	D590G	probably benign	Het
Lipt1	T	G	1: 37,875,529	L222R	probably damaging	Het
Lrrc41	A	G	4: 116,093,177		probably benign	Het
Lrrc59	T	C	11: 94,634,672	V98A	probably benign	Het
Mast4	A	G	13: 102,774,184		probably null	Het
Mdc1	C	T	17: 35,850,394	S733F	probably benign	Het
Mknk1	C	T	4: 115,878,186		probably benign	Het
Mtmr7	A	G	8: 40,590,462	F141S	probably damaging	Het
Myo15b	A	G	11: 115,887,602	D1G	possibly damaging	Het
Odf3	T	C	7: 140,848,278	M1T	probably null	Het
Olfr1356	T	G	10: 78,847,575	L113F	probably damaging	Het
Phkb	T	A	8: 85,901,911	V183E	probably damaging	Het
Pola2	T	C	19: 5,953,864	Y161C	probably damaging	Het
Psen1	G	A	12: 83,731,778	V412I	probably benign	Het
Psmc4	C	A	7: 28,047,512	G77V	probably damaging	Het
Psmd3	A	G	11: 98,687,760	Y207C	probably damaging	Het
Pxk	T	A	14: 8,130,653	M84K	probably damaging	Het
Rab44	A	C	17: 29,136,337	Q19P	probably damaging	Het
Rbks	A	G	5: 31,624,515	Y314H	probably benign	Het
Rftn2	T	C	1: 55,214,240	D68G	possibly damaging	Het
Rims2	T	A	15: 39,535,914	S838R	probably damaging	Het
Sdc4	A	T	2: 164,431,218	D57E	probably damaging	Het
Slfn14	A	G	11: 83,279,156	L554P	probably damaging	Het
Spink2	G	T	5: 77,205,392	D83E	possibly damaging	Het
Srsf4	C	T	4: 131,900,102		probably benign	Het
Taar8b	A	T	10: 24,092,132	S55T	possibly damaging	Het
Tbca	A	G	13: 94,832,410	E35G	probably benign	Het
Tmc5	C	A	7: 118,628,829	H307Q	probably benign	Het
Tmem169	A	G	1: 72,298,152	D82G	probably benign	Het
Tmem72	T	C	6: 116,698,358	T58A	probably benign	Het
Ttc7	C	T	17: 87,334,321	P449S	probably damaging	Het
Ttf2	T	C	3: 100,961,406	E449G	probably benign	Het
Ubr4	C	A	4: 139,402,546	T659K	probably damaging	Het
Wdr1	A	G	5: 38,547,029	Y98H	probably damaging	Het
Wfikkn2	A	G	11: 94,239,052	Y88H	probably benign	Het
Zfp384	A	T	6: 125,030,848	H247L	probably damaging	Het
Zfp526	C	T	7: 25,225,870	A518V	probably damaging	Het
Zfp788	T	A	7: 41,647,568	H47Q	probably benign	Het

Other mutations in Abca5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00487:Abca5	APN	11	110309450	critical splice acceptor site	probably null
IGL00675:Abca5	APN	11	110304985	missense	probably damaging	1.00
IGL01512:Abca5	APN	11	110317823	missense	probably benign	0.40
IGL01559:Abca5	APN	11	110272526	missense	probably benign
IGL01584:Abca5	APN	11	110304923	missense	probably damaging	0.98
IGL01604:Abca5	APN	11	110277636	missense	possibly damaging	0.47
IGL01828:Abca5	APN	11	110287695	missense	probably benign
IGL01880:Abca5	APN	11	110293263	missense	probably benign	0.01
IGL02054:Abca5	APN	11	110292123	missense	probably damaging	0.99
IGL02074:Abca5	APN	11	110293350	missense	probably benign	0.00
IGL02233:Abca5	APN	11	110274344	nonsense	probably null
IGL02245:Abca5	APN	11	110298169	nonsense	probably null
IGL02317:Abca5	APN	11	110327761	missense	probably benign	0.09
IGL02352:Abca5	APN	11	110275330	missense	probably benign	0.01
IGL02359:Abca5	APN	11	110275330	missense	probably benign	0.01
IGL02390:Abca5	APN	11	110296551	missense	probably benign
IGL02600:Abca5	APN	11	110309438	missense	probably benign	0.02
IGL02639:Abca5	APN	11	110288073	missense	possibly damaging	0.79
IGL03000:Abca5	APN	11	110317814	missense	probably benign	0.04
IGL03074:Abca5	APN	11	110310275	missense	probably benign	0.01
IGL03078:Abca5	APN	11	110276545	nonsense	probably null
IGL03342:Abca5	APN	11	110287691	missense	possibly damaging	0.94
IGL03368:Abca5	APN	11	110313522	splice site	probably benign
atles	UTSW	11	110299929	missense	probably damaging	0.99
Demento	UTSW	11	110310233	missense	probably damaging	1.00
jones	UTSW	11	110288058	splice site	probably null
smith	UTSW	11	110301545	missense	probably benign	0.22
R0106:Abca5	UTSW	11	110319825	missense	probably damaging	1.00
R0116:Abca5	UTSW	11	110276505	missense	probably damaging	1.00
R0305:Abca5	UTSW	11	110273311	splice site	probably benign
R0550:Abca5	UTSW	11	110293840	missense	probably damaging	1.00
R0578:Abca5	UTSW	11	110276489	nonsense	probably null
R0587:Abca5	UTSW	11	110311377	missense	probably benign	0.00
R0610:Abca5	UTSW	11	110301527	missense	probably benign	0.00
R0617:Abca5	UTSW	11	110279689	missense	probably damaging	0.98
R0667:Abca5	UTSW	11	110327811	missense	probably benign	0.00
R0844:Abca5	UTSW	11	110319832	missense	probably benign	0.00
R1273:Abca5	UTSW	11	110326665	missense	probably benign	0.01
R1463:Abca5	UTSW	11	110314558	missense	probably damaging	1.00
R1511:Abca5	UTSW	11	110299978	missense	probably damaging	1.00
R1511:Abca5	UTSW	11	110299986	missense	possibly damaging	0.73
R1687:Abca5	UTSW	11	110293888	missense	probably benign	0.32
R1759:Abca5	UTSW	11	110293848	missense	probably benign
R1870:Abca5	UTSW	11	110329217	missense	probably benign	0.33
R2006:Abca5	UTSW	11	110313449	missense	probably benign
R2039:Abca5	UTSW	11	110299929	missense	probably damaging	0.99
R2076:Abca5	UTSW	11	110287652	missense	probably benign	0.10
R2136:Abca5	UTSW	11	110319832	missense	probably benign	0.00
R2154:Abca5	UTSW	11	110292174	missense	probably benign	0.00
R2273:Abca5	UTSW	11	110275281	missense	possibly damaging	0.93
R2274:Abca5	UTSW	11	110275281	missense	possibly damaging	0.93
R2275:Abca5	UTSW	11	110275281	missense	possibly damaging	0.93
R2328:Abca5	UTSW	11	110276521	missense	probably damaging	0.99
R3702:Abca5	UTSW	11	110288058	splice site	probably null
R3768:Abca5	UTSW	11	110313391	missense	probably benign	0.01
R3872:Abca5	UTSW	11	110310233	missense	probably damaging	1.00
R3873:Abca5	UTSW	11	110310233	missense	probably damaging	1.00
R3874:Abca5	UTSW	11	110310233	missense	probably damaging	1.00
R3875:Abca5	UTSW	11	110310233	missense	probably damaging	1.00
R4347:Abca5	UTSW	11	110299968	missense	probably damaging	1.00
R4429:Abca5	UTSW	11	110311410	missense	probably benign	0.00
R4790:Abca5	UTSW	11	110311410	missense	possibly damaging	0.63
R4812:Abca5	UTSW	11	110301821	missense	probably damaging	1.00
R4883:Abca5	UTSW	11	110326631	missense	probably damaging	1.00
R5000:Abca5	UTSW	11	110310224	missense	probably damaging	1.00
R5004:Abca5	UTSW	11	110279376	missense	probably damaging	0.99
R5066:Abca5	UTSW	11	110309350	intron	probably benign
R5230:Abca5	UTSW	11	110319860	missense	probably benign
R5321:Abca5	UTSW	11	110327825	missense	probably benign
R5350:Abca5	UTSW	11	110319796	nonsense	probably null
R5414:Abca5	UTSW	11	110314622	missense	probably damaging	1.00
R5437:Abca5	UTSW	11	110319796	nonsense	probably null
R5451:Abca5	UTSW	11	110319796	nonsense	probably null
R5453:Abca5	UTSW	11	110319796	nonsense	probably null
R5488:Abca5	UTSW	11	110292183	missense	probably benign	0.00
R5636:Abca5	UTSW	11	110301536	missense	probably benign	0.00
R5805:Abca5	UTSW	11	110279390	missense	probably benign	0.06
R5900:Abca5	UTSW	11	110279156	missense	possibly damaging	0.92
R6152:Abca5	UTSW	11	110313361	missense	probably damaging	1.00
R6167:Abca5	UTSW	11	110292105	missense	probably benign	0.10
R6343:Abca5	UTSW	11	110314552	missense	probably damaging	1.00
R6425:Abca5	UTSW	11	110329232	missense	possibly damaging	0.75
R6493:Abca5	UTSW	11	110293878	missense	probably benign	0.00
R6498:Abca5	UTSW	11	110292102	missense	possibly damaging	0.70
R6884:Abca5	UTSW	11	110329217	missense	probably damaging	0.96
R6912:Abca5	UTSW	11	110306280	missense	probably benign	0.35
R7084:Abca5	UTSW	11	110301545	missense	probably benign	0.22
R7239:Abca5	UTSW	11	110326704	missense	possibly damaging	0.94
R7490:Abca5	UTSW	11	110277611	missense	possibly damaging	0.95
R7527:Abca5	UTSW	11	110327730	critical splice donor site	probably null
R7702:Abca5	UTSW	11	110276452	critical splice donor site	probably null
R7763:Abca5	UTSW	11	110272497	missense	possibly damaging	0.85
R8237:Abca5	UTSW	11	110310155	missense	probably benign	0.01
R8910:Abca5	UTSW	11	110298204	missense	probably damaging	0.96
R9028:Abca5	UTSW	11	110298078	missense	probably damaging	1.00
R9124:Abca5	UTSW	11	110298179	missense	possibly damaging	0.91
R9151:Abca5	UTSW	11	110298082	missense	probably benign
R9187:Abca5	UTSW	11	110310135	critical splice donor site	probably null
R9249:Abca5	UTSW	11	110329339	intron	probably benign
R9322:Abca5	UTSW	11	110301505	missense	probably damaging	0.96
R9391:Abca5	UTSW	11	110287716	missense	probably benign
R9435:Abca5	UTSW	11	110292085	critical splice donor site	unknown
RF014:Abca5	UTSW	11	110279754	critical splice acceptor site	probably null
Z1177:Abca5	UTSW	11	110279328	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TTAATGACTGTGCTTTTGCCAGC -3'
(R):5'- TTACCAAGGCACTGGAATGAAG -3'

Sequencing Primer
(F):5'- GCTCCATTTGGACCCAACAGTC -3'
(R):5'- ATTTATTTTACACTGCCCTCTTAGAG -3'

Posted On

2016-03-01