Incidental Mutation 'R4833:Pxk'
ID373015
Institutional Source Beutler Lab
Gene Symbol Pxk
Ensembl Gene ENSMUSG00000033885
Gene NamePX domain containing serine/threonine kinase
SynonymsMONaKA, D14Ertd813e, C230080L11Rik
MMRRC Submission 042449-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R4833 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location8098211-8165117 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8130653 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 84 (M84K)
Ref Sequence ENSEMBL: ENSMUSP00000152987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036682] [ENSMUST00000112689] [ENSMUST00000225653]
Predicted Effect probably benign
Transcript: ENSMUST00000036682
AA Change: M84K

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000035265
Gene: ENSMUSG00000033885
AA Change: M84K

DomainStartEndE-ValueType
PX 17 122 1.62e-16 SMART
Pfam:Pkinase 183 441 1.1e-9 PFAM
Pfam:Pkinase_Tyr 185 309 2.5e-7 PFAM
low complexity region 483 536 N/A INTRINSIC
Pfam:WH2 549 577 1.8e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112689
AA Change: M84K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108309
Gene: ENSMUSG00000033885
AA Change: M84K

DomainStartEndE-ValueType
PX 17 122 1.62e-16 SMART
Pfam:Pkinase_Tyr 185 309 3e-7 PFAM
Pfam:Pkinase 185 441 1.4e-10 PFAM
low complexity region 483 509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225616
Predicted Effect probably damaging
Transcript: ENSMUST00000225653
AA Change: M84K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.7005 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phox (PX) domain-containing protein which may be involved in synaptic transmission and the ligand-induced internalization and degradation of epidermal growth factors. Variations in this gene may be associated with susceptibility to systemic lupus erythematosus (SLE). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C A 19: 3,716,872 T153K possibly damaging Het
4932438A13Rik A G 3: 36,964,968 I2007V probably damaging Het
Abca5 A C 11: 110,279,316 Y1318D probably benign Het
Adam18 A G 8: 24,674,101 I22T probably benign Het
Adgrv1 T A 13: 81,560,844 H1147L possibly damaging Het
Ankrd2 T C 19: 42,043,857 probably null Het
Bdkrb2 T C 12: 105,591,658 W53R probably benign Het
Blm T A 7: 80,466,826 I1111L probably benign Het
Bmp3 T G 5: 98,855,207 L32R probably damaging Het
Cdh23 T G 10: 60,385,038 E1312A probably damaging Het
Ceacam5 C T 7: 17,752,258 T560M probably benign Het
Cmtm8 C A 9: 114,796,165 R66I probably benign Het
Cnbd1 A G 4: 18,862,120 Y357H probably damaging Het
Col4a4 A T 1: 82,529,602 V252E unknown Het
Col6a4 A T 9: 106,071,979 M819K probably benign Het
Cwf19l2 T C 9: 3,430,783 S372P probably benign Het
Daam2 A T 17: 49,490,145 I204N possibly damaging Het
Dock6 T C 9: 21,844,280 D216G probably damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Erich2 T C 2: 70,534,292 Y311H possibly damaging Het
Gm3985 A G 8: 32,890,477 noncoding transcript Het
Gnb1 A G 4: 155,543,067 T102A possibly damaging Het
Hcfc2 C T 10: 82,709,146 A204V probably null Het
Hnrnpu T C 1: 178,333,894 probably benign Het
Htt A G 5: 34,852,225 T1517A probably damaging Het
Klhl6 T A 16: 19,957,139 D223V probably damaging Het
Kpna6 A G 4: 129,657,779 S71P possibly damaging Het
Lama3 A G 18: 12,441,131 D590G probably benign Het
Lipt1 T G 1: 37,875,529 L222R probably damaging Het
Lrrc41 A G 4: 116,093,177 probably benign Het
Lrrc59 T C 11: 94,634,672 V98A probably benign Het
Mast4 A G 13: 102,774,184 probably null Het
Mdc1 C T 17: 35,850,394 S733F probably benign Het
Mknk1 C T 4: 115,878,186 probably benign Het
Mtmr7 A G 8: 40,590,462 F141S probably damaging Het
Myo15b A G 11: 115,887,602 D1G possibly damaging Het
Odf3 T C 7: 140,848,278 M1T probably null Het
Olfr1356 T G 10: 78,847,575 L113F probably damaging Het
Phkb T A 8: 85,901,911 V183E probably damaging Het
Pola2 T C 19: 5,953,864 Y161C probably damaging Het
Psen1 G A 12: 83,731,778 V412I probably benign Het
Psmc4 C A 7: 28,047,512 G77V probably damaging Het
Psmd3 A G 11: 98,687,760 Y207C probably damaging Het
Rab44 A C 17: 29,136,337 Q19P probably damaging Het
Rbks A G 5: 31,624,515 Y314H probably benign Het
Rftn2 T C 1: 55,214,240 D68G possibly damaging Het
Rims2 T A 15: 39,535,914 S838R probably damaging Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Slfn14 A G 11: 83,279,156 L554P probably damaging Het
Spink2 G T 5: 77,205,392 D83E possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Taar8b A T 10: 24,092,132 S55T possibly damaging Het
Tbca A G 13: 94,832,410 E35G probably benign Het
Tmc5 C A 7: 118,628,829 H307Q probably benign Het
Tmem169 A G 1: 72,298,152 D82G probably benign Het
Tmem72 T C 6: 116,698,358 T58A probably benign Het
Ttc7 C T 17: 87,334,321 P449S probably damaging Het
Ttf2 T C 3: 100,961,406 E449G probably benign Het
Ubr4 C A 4: 139,402,546 T659K probably damaging Het
Wdr1 A G 5: 38,547,029 Y98H probably damaging Het
Wfikkn2 A G 11: 94,239,052 Y88H probably benign Het
Zfp384 A T 6: 125,030,848 H247L probably damaging Het
Zfp526 C T 7: 25,225,870 A518V probably damaging Het
Zfp788 T A 7: 41,647,568 H47Q probably benign Het
Other mutations in Pxk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Pxk APN 14 8130754 missense probably damaging 1.00
IGL01865:Pxk APN 14 8136923 missense possibly damaging 0.94
IGL03171:Pxk APN 14 8151014 splice site probably benign
PIT4131001:Pxk UTSW 14 8152130 missense probably benign 0.01
R0799:Pxk UTSW 14 8148123 missense probably benign 0.02
R1367:Pxk UTSW 14 8150915 splice site probably null
R1546:Pxk UTSW 14 8164091 missense probably damaging 1.00
R1800:Pxk UTSW 14 8151507 nonsense probably null
R1827:Pxk UTSW 14 8151507 nonsense probably null
R1828:Pxk UTSW 14 8151507 nonsense probably null
R1888:Pxk UTSW 14 8151540 missense probably damaging 1.00
R1888:Pxk UTSW 14 8151540 missense probably damaging 1.00
R1892:Pxk UTSW 14 8151507 nonsense probably null
R1893:Pxk UTSW 14 8151507 nonsense probably null
R3766:Pxk UTSW 14 8136863 splice site probably benign
R4807:Pxk UTSW 14 8144133 missense probably damaging 1.00
R4816:Pxk UTSW 14 8136893 missense probably damaging 1.00
R4974:Pxk UTSW 14 8140734 missense probably damaging 1.00
R5400:Pxk UTSW 14 8136911 missense probably benign 0.45
R6075:Pxk UTSW 14 8150964 missense probably benign 0.05
R6144:Pxk UTSW 14 8138011 missense probably damaging 0.99
R6211:Pxk UTSW 14 8163952 missense probably damaging 0.96
R6997:Pxk UTSW 14 8122371 missense probably benign 0.29
R7266:Pxk UTSW 14 8146220 missense probably benign 0.00
R7363:Pxk UTSW 14 8152118 missense probably benign 0.01
R7949:Pxk UTSW 14 8144233 missense probably damaging 1.00
R8302:Pxk UTSW 14 8164094 missense probably damaging 1.00
Z1176:Pxk UTSW 14 8146271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTGCATCTTCAAAGTCTATATTG -3'
(R):5'- AAAGAAACCCTGCCCTGTTGC -3'

Sequencing Primer
(F):5'- CCATCATGCTTCAGGACT -3'
(R):5'- AACCCTGCCCTGTTGCAAATG -3'
Posted On2016-03-01