Incidental Mutation 'R4833:Klhl6'
ID373017
Institutional Source Beutler Lab
Gene Symbol Klhl6
Ensembl Gene ENSMUSG00000043008
Gene Namekelch-like 6
Synonyms
MMRRC Submission 042449-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R4833 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location19946496-19983037 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19957139 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 223 (D223V)
Ref Sequence ENSEMBL: ENSMUSP00000053023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058839] [ENSMUST00000166801]
Predicted Effect probably damaging
Transcript: ENSMUST00000058839
AA Change: D223V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053023
Gene: ENSMUSG00000043008
AA Change: D223V

DomainStartEndE-ValueType
BTB 70 167 1.43e-25 SMART
BACK 172 274 1.68e-35 SMART
Kelch 376 419 3.05e-1 SMART
Kelch 420 466 6.82e-11 SMART
Kelch 467 514 4.27e-3 SMART
Kelch 515 556 3.06e-4 SMART
Kelch 557 604 3.47e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166801
SMART Domains Protein: ENSMUSP00000130755
Gene: ENSMUSG00000043008

DomainStartEndE-ValueType
Pfam:BTB 60 98 1.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171910
Meta Mutation Damage Score 0.9688 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kelch-like (KLHL) family of proteins, which is involved in B-lymphocyte antigen receptor signaling and germinal-center B-cell maturation. The encoded protein contains an N-terminal broad-complex, tramtrack and bric a brac (BTB) domain that facilitates protein binding and dimerization, a BTB and C-terminal kelch (BACK) domain, and six C-terminal kelch repeat domains. Naturally occurring mutations in this gene are associated with chronic lymphocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spleen hypoplasia, defects in mature B-cell subsets with normal pro- and pre-B-cell development, severely impaired antigen-dependent germinal center formation, and reduced memory IgG response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C A 19: 3,716,872 T153K possibly damaging Het
4932438A13Rik A G 3: 36,964,968 I2007V probably damaging Het
Abca5 A C 11: 110,279,316 Y1318D probably benign Het
Adam18 A G 8: 24,674,101 I22T probably benign Het
Adgrv1 T A 13: 81,560,844 H1147L possibly damaging Het
Ankrd2 T C 19: 42,043,857 probably null Het
Bdkrb2 T C 12: 105,591,658 W53R probably benign Het
Blm T A 7: 80,466,826 I1111L probably benign Het
Bmp3 T G 5: 98,855,207 L32R probably damaging Het
Cdh23 T G 10: 60,385,038 E1312A probably damaging Het
Ceacam5 C T 7: 17,752,258 T560M probably benign Het
Cmtm8 C A 9: 114,796,165 R66I probably benign Het
Cnbd1 A G 4: 18,862,120 Y357H probably damaging Het
Col4a4 A T 1: 82,529,602 V252E unknown Het
Col6a4 A T 9: 106,071,979 M819K probably benign Het
Cwf19l2 T C 9: 3,430,783 S372P probably benign Het
Daam2 A T 17: 49,490,145 I204N possibly damaging Het
Dock6 T C 9: 21,844,280 D216G probably damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Erich2 T C 2: 70,534,292 Y311H possibly damaging Het
Gm3985 A G 8: 32,890,477 noncoding transcript Het
Gnb1 A G 4: 155,543,067 T102A possibly damaging Het
Hcfc2 C T 10: 82,709,146 A204V probably null Het
Hnrnpu T C 1: 178,333,894 probably benign Het
Htt A G 5: 34,852,225 T1517A probably damaging Het
Kpna6 A G 4: 129,657,779 S71P possibly damaging Het
Lama3 A G 18: 12,441,131 D590G probably benign Het
Lipt1 T G 1: 37,875,529 L222R probably damaging Het
Lrrc41 A G 4: 116,093,177 probably benign Het
Lrrc59 T C 11: 94,634,672 V98A probably benign Het
Mast4 A G 13: 102,774,184 probably null Het
Mdc1 C T 17: 35,850,394 S733F probably benign Het
Mknk1 C T 4: 115,878,186 probably benign Het
Mtmr7 A G 8: 40,590,462 F141S probably damaging Het
Myo15b A G 11: 115,887,602 D1G possibly damaging Het
Odf3 T C 7: 140,848,278 M1T probably null Het
Olfr1356 T G 10: 78,847,575 L113F probably damaging Het
Phkb T A 8: 85,901,911 V183E probably damaging Het
Pola2 T C 19: 5,953,864 Y161C probably damaging Het
Psen1 G A 12: 83,731,778 V412I probably benign Het
Psmc4 C A 7: 28,047,512 G77V probably damaging Het
Psmd3 A G 11: 98,687,760 Y207C probably damaging Het
Pxk T A 14: 8,130,653 M84K probably damaging Het
Rab44 A C 17: 29,136,337 Q19P probably damaging Het
Rbks A G 5: 31,624,515 Y314H probably benign Het
Rftn2 T C 1: 55,214,240 D68G possibly damaging Het
Rims2 T A 15: 39,535,914 S838R probably damaging Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Slfn14 A G 11: 83,279,156 L554P probably damaging Het
Spink2 G T 5: 77,205,392 D83E possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Taar8b A T 10: 24,092,132 S55T possibly damaging Het
Tbca A G 13: 94,832,410 E35G probably benign Het
Tmc5 C A 7: 118,628,829 H307Q probably benign Het
Tmem169 A G 1: 72,298,152 D82G probably benign Het
Tmem72 T C 6: 116,698,358 T58A probably benign Het
Ttc7 C T 17: 87,334,321 P449S probably damaging Het
Ttf2 T C 3: 100,961,406 E449G probably benign Het
Ubr4 C A 4: 139,402,546 T659K probably damaging Het
Wdr1 A G 5: 38,547,029 Y98H probably damaging Het
Wfikkn2 A G 11: 94,239,052 Y88H probably benign Het
Zfp384 A T 6: 125,030,848 H247L probably damaging Het
Zfp526 C T 7: 25,225,870 A518V probably damaging Het
Zfp788 T A 7: 41,647,568 H47Q probably benign Het
Other mutations in Klhl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Klhl6 APN 16 19957062 missense probably benign 0.00
IGL01465:Klhl6 APN 16 19982822 missense probably damaging 0.98
IGL01831:Klhl6 APN 16 19953485 missense probably damaging 1.00
IGL01971:Klhl6 APN 16 19949526 missense probably damaging 0.99
IGL02532:Klhl6 APN 16 19957082 missense possibly damaging 0.84
IGL03113:Klhl6 APN 16 19957251 missense possibly damaging 0.68
IGL03290:Klhl6 APN 16 19947137 missense probably benign 0.44
Ascension UTSW 16 19947098 missense probably damaging 1.00
besmirched UTSW 16 19949447 splice site probably null
blau UTSW 16 19957005 missense probably damaging 1.00
blossom UTSW 16 19957139 missense probably damaging 1.00
cerulean UTSW 16 19957218 nonsense probably null
heights UTSW 16 19957028 missense probably damaging 0.98
Lazuli UTSW 16 19956966 frame shift probably null
Parula UTSW 16 19957043 missense possibly damaging 0.56
torres_del_paine UTSW 16 19948127 missense probably damaging 1.00
turquoise UTSW 16 19982796 missense probably damaging 1.00
IGL03046:Klhl6 UTSW 16 19982889 missense probably benign
R0265:Klhl6 UTSW 16 19948234 missense probably benign 0.43
R0496:Klhl6 UTSW 16 19956966 frame shift probably null
R0497:Klhl6 UTSW 16 19956966 frame shift probably null
R0540:Klhl6 UTSW 16 19957014 missense possibly damaging 0.95
R0541:Klhl6 UTSW 16 19949447 splice site probably null
R0554:Klhl6 UTSW 16 19953593 missense probably damaging 0.96
R0607:Klhl6 UTSW 16 19957014 missense possibly damaging 0.95
R0636:Klhl6 UTSW 16 19948073 splice site probably benign
R0670:Klhl6 UTSW 16 19949559 missense possibly damaging 0.92
R1477:Klhl6 UTSW 16 19965977 missense probably benign 0.00
R1510:Klhl6 UTSW 16 19947098 missense probably damaging 1.00
R1547:Klhl6 UTSW 16 19966082 missense probably benign
R1747:Klhl6 UTSW 16 19947028 missense probably benign 0.40
R1871:Klhl6 UTSW 16 19957043 missense possibly damaging 0.56
R1966:Klhl6 UTSW 16 19982822 missense probably damaging 0.98
R2058:Klhl6 UTSW 16 19982931 missense probably benign
R4466:Klhl6 UTSW 16 19957268 missense probably damaging 0.99
R4645:Klhl6 UTSW 16 19947147 missense probably damaging 1.00
R4690:Klhl6 UTSW 16 19957284 missense probably benign 0.44
R4824:Klhl6 UTSW 16 19957028 missense probably damaging 0.98
R4835:Klhl6 UTSW 16 19957033 missense probably benign 0.07
R5001:Klhl6 UTSW 16 19946991 makesense probably null
R5475:Klhl6 UTSW 16 19948127 missense probably damaging 1.00
R5700:Klhl6 UTSW 16 19957218 nonsense probably null
R5867:Klhl6 UTSW 16 19982820 missense probably benign 0.37
R5910:Klhl6 UTSW 16 19957094 missense probably benign 0.04
R6992:Klhl6 UTSW 16 19953587 missense probably damaging 1.00
R7082:Klhl6 UTSW 16 19982883 missense probably benign 0.00
R7262:Klhl6 UTSW 16 19982796 missense probably damaging 1.00
R7314:Klhl6 UTSW 16 19957005 missense probably damaging 1.00
R7464:Klhl6 UTSW 16 19957113 missense possibly damaging 0.58
R7688:Klhl6 UTSW 16 19947131 missense probably damaging 1.00
R8319:Klhl6 UTSW 16 19957190 missense possibly damaging 0.74
Z1176:Klhl6 UTSW 16 19953674 missense probably damaging 1.00
Z1177:Klhl6 UTSW 16 19982961 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTACATCCTGGCTTCCTG -3'
(R):5'- CTCACAGAAGCATTGAACCCGG -3'

Sequencing Primer
(F):5'- GACTTCAGGGCACTGTCTAATAAG -3'
(R):5'- GCATTGAACCCGGAAAATTGTATTGG -3'
Posted On2016-03-01