Incidental Mutation 'R4834:Hecw2'
ID373029
Institutional Source Beutler Lab
Gene Symbol Hecw2
Ensembl Gene ENSMUSG00000042807
Gene NameHECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
SynonymsA730039N16Rik, Nedl2, D030049F17Rik
MMRRC Submission 041977-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.625) question?
Stock #R4834 (G1)
Quality Score203
Status Not validated
Chromosome1
Chromosomal Location53806876-54195168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53830752 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1439 (V1439E)
Ref Sequence ENSEMBL: ENSMUSP00000113283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087659] [ENSMUST00000120904]
Predicted Effect probably damaging
Transcript: ENSMUST00000087659
AA Change: V1439E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084942
Gene: ENSMUSG00000042807
AA Change: V1439E

DomainStartEndE-ValueType
Pfam:HECW_N 45 164 4.6e-62 PFAM
low complexity region 165 178 N/A INTRINSIC
C2 186 297 2.19e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 746 755 N/A INTRINSIC
low complexity region 769 786 N/A INTRINSIC
WW 814 846 1.21e-11 SMART
coiled coil region 853 880 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
WW 992 1024 2.12e-7 SMART
Blast:HECTc 1111 1183 2e-23 BLAST
HECTc 1241 1578 8.02e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120904
AA Change: V1439E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113283
Gene: ENSMUSG00000042807
AA Change: V1439E

DomainStartEndE-ValueType
PDB:2LFE|A 42 162 6e-80 PDB
low complexity region 165 178 N/A INTRINSIC
C2 186 297 2.19e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 746 755 N/A INTRINSIC
low complexity region 769 786 N/A INTRINSIC
WW 814 846 1.21e-11 SMART
coiled coil region 853 880 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
WW 992 1024 2.12e-7 SMART
Blast:HECTc 1111 1183 2e-23 BLAST
HECTc 1241 1578 8.02e-183 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150677
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of E3 ubiquitin ligases which plays an important role in the proliferation, migration and differentiation of neural crest cells as a regulator of glial cell line-derived neurotrophic factor (GDNF)/Ret signaling. This gene also plays an important role in angiogenesis through stabilization of endothelial cell-to-cell junctions as a regulator of angiomotin-like 1 stability. The encoded protein contains an N-terminal calcium/lipid-binding (C2) domain involved in membrane targeting, two-four WW domains responsible for cellular localization and substrate recognition, and a C-terminal homologous with E6-associated protein C-terminus (HECT) catalytic domain. Naturally occurring mutations in this gene are associated with neurodevelopmental delay, hypotonia, and epilepsy. The decreased expression of this gene in the aganglionic colon is associated with Hirschsprung's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A C 9: 53,432,487 D146A possibly damaging Het
Acsl5 C A 19: 55,280,559 D217E probably benign Het
Acss3 A G 10: 107,084,805 probably null Het
Adam24 G A 8: 40,679,699 G69R probably damaging Het
Adgrg7 A T 16: 56,732,869 W622R probably damaging Het
Ankrd26 T C 6: 118,523,718 M931V probably benign Het
Ano8 C T 8: 71,484,295 V187M probably damaging Het
Ap3d1 A T 10: 80,719,726 C348S probably damaging Het
Apob T C 12: 8,014,101 V376A possibly damaging Het
Arhgap21 A T 2: 20,865,319 D925E probably damaging Het
Bmp6 T A 13: 38,485,841 V367E probably damaging Het
Bmp8b A T 4: 123,123,050 Q348L probably damaging Het
Ccr1l1 T C 9: 123,977,705 K235R probably damaging Het
Cd59a G A 2: 104,114,086 C93Y probably damaging Het
Clstn3 C T 6: 124,431,953 probably null Het
Col4a2 C A 8: 11,406,836 Y236* probably null Het
Csn1s2a T C 5: 87,781,778 F79L probably benign Het
Cyp4a10 A C 4: 115,525,808 Y360S probably damaging Het
Cyp4a29 A T 4: 115,249,670 I175F probably benign Het
D11Wsu47e C A 11: 113,688,979 T400K probably benign Het
Dck T A 5: 88,772,736 I105N probably damaging Het
Dicer1 A G 12: 104,696,591 L1577P probably benign Het
Dirc2 T A 16: 35,735,575 T172S probably benign Het
Disp2 G A 2: 118,792,504 S1239N probably benign Het
Dopey2 T C 16: 93,740,004 M1T probably null Het
E130308A19Rik T A 4: 59,690,317 C50* probably null Het
Elf2 A T 3: 51,277,221 D14E probably damaging Het
Epm2aip1 C T 9: 111,273,194 R412C probably benign Het
Foxm1 T C 6: 128,369,447 F114L probably damaging Het
Glcci1 C T 6: 8,582,601 R134* probably null Het
Gm996 T C 2: 25,579,518 E127G possibly damaging Het
Gspt1 T C 16: 11,222,717 K576E probably damaging Het
H2-M10.3 T C 17: 36,367,394 K180E probably benign Het
Hr T C 14: 70,559,922 S561P probably damaging Het
Hunk T C 16: 90,496,198 V456A probably benign Het
Il1rap T A 16: 26,676,935 D97E probably damaging Het
Inpp5d T G 1: 87,697,523 V474G possibly damaging Het
Itsn1 T A 16: 91,906,789 L87* probably null Het
Izumo3 T C 4: 92,146,971 D3G possibly damaging Het
Kifc2 T A 15: 76,661,311 M1K probably null Het
Krt8 T A 15: 101,998,821 I276F probably damaging Het
Ksr2 C A 5: 117,668,327 Q402K probably benign Het
Lama2 A G 10: 27,006,749 V2606A probably benign Het
Met A G 6: 17,491,413 H58R probably damaging Het
Mier3 C T 13: 111,715,109 Q542* probably null Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Msl3l2 C T 10: 56,115,559 R127C probably damaging Het
Naglu T C 11: 101,076,988 L588P probably benign Het
Nf1 T C 11: 79,546,297 L2013P probably damaging Het
Nid1 A G 13: 13,508,823 Y1162C probably damaging Het
Nlrc5 G T 8: 94,505,485 R1313L probably benign Het
Nrg1 A G 8: 31,917,719 V162A probably benign Het
Nup188 T C 2: 30,339,584 L1310P probably damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1310 A G 2: 112,008,931 L85P probably damaging Het
Olfr290 T G 7: 84,916,283 F168C probably damaging Het
Olfr305 G A 7: 86,363,744 L198F probably benign Het
Pbk T A 14: 65,815,284 L192* probably null Het
Pcdhga4 T C 18: 37,685,437 I13T probably benign Het
Peg10 A T 6: 4,754,294 probably benign Het
Polq T A 16: 37,027,814 V261D probably damaging Het
Ppp2r5b T A 19: 6,230,510 T313S possibly damaging Het
Ptk2 A T 15: 73,216,096 probably null Het
Ptpn7 T A 1: 135,137,880 probably null Het
Rab11fip1 A G 8: 27,153,083 S563P probably damaging Het
Scn1a A T 2: 66,328,522 C351* probably null Het
Slc10a5 A T 3: 10,334,799 V267D probably damaging Het
Slc37a2 T A 9: 37,235,108 M368L probably damaging Het
Slc6a20b T A 9: 123,596,048 T585S probably benign Het
Srcap T C 7: 127,557,610 probably null Het
Tbx18 T C 9: 87,727,449 M178V possibly damaging Het
Tmprss11b C A 5: 86,663,559 C172F probably damaging Het
Traf5 T C 1: 192,066,898 Q91R probably benign Het
Trappc8 A T 18: 20,825,065 Y1248N probably damaging Het
Trpa1 A G 1: 14,896,523 L539S possibly damaging Het
Tyrp1 T A 4: 80,846,596 Y3* probably null Het
Ubr7 A T 12: 102,761,502 K94N probably damaging Het
Ugt2a1 C A 5: 87,486,035 probably null Het
Unc50 T A 1: 37,432,629 I120K probably damaging Het
Usp28 T C 9: 49,001,536 V29A probably damaging Het
Usp9y A G Y: 1,317,002 I1849T probably benign Het
Vmn2r102 T A 17: 19,677,941 V406E probably damaging Het
Vmn2r4 G A 3: 64,410,063 R85W probably benign Het
Xirp2 A G 2: 67,516,406 D2997G probably benign Het
Zc2hc1c A T 12: 85,290,208 E213V probably damaging Het
Zfp420 C T 7: 29,874,334 probably benign Het
Zfp641 C T 15: 98,293,704 E34K probably damaging Het
Other mutations in Hecw2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Hecw2 APN 1 53830737 missense probably damaging 1.00
IGL00338:Hecw2 APN 1 53827881 splice site probably benign
IGL00530:Hecw2 APN 1 53853280 missense probably damaging 1.00
IGL01343:Hecw2 APN 1 53826976 missense probably damaging 0.96
IGL01503:Hecw2 APN 1 53826961 missense probably damaging 1.00
IGL01989:Hecw2 APN 1 53840792 missense probably damaging 1.00
IGL02016:Hecw2 APN 1 53831543 missense possibly damaging 0.73
IGL02052:Hecw2 APN 1 53926511 missense probably benign
IGL02085:Hecw2 APN 1 53942802 critical splice acceptor site probably null
IGL02302:Hecw2 APN 1 53933248 missense probably damaging 1.00
IGL02310:Hecw2 APN 1 53923916 missense probably null 0.38
IGL02388:Hecw2 APN 1 53925699 missense probably benign 0.17
IGL02499:Hecw2 APN 1 53926488 missense probably benign
IGL02695:Hecw2 APN 1 53926209 missense possibly damaging 0.94
IGL02732:Hecw2 APN 1 53926688 splice site probably benign
IGL03100:Hecw2 APN 1 53831656 missense probably damaging 1.00
IGL03175:Hecw2 APN 1 53926257 missense possibly damaging 0.51
IGL03253:Hecw2 APN 1 53832716 missense possibly damaging 0.85
IGL03356:Hecw2 APN 1 53927058 splice site probably benign
Memoriam UTSW 1 53926056 missense probably benign
recollect UTSW 1 53904422 missense possibly damaging 0.88
ANU74:Hecw2 UTSW 1 53925694 missense probably benign 0.01
R0077:Hecw2 UTSW 1 53868831 splice site probably benign
R0133:Hecw2 UTSW 1 53830740 missense probably damaging 1.00
R0268:Hecw2 UTSW 1 53926698 splice site probably benign
R1303:Hecw2 UTSW 1 54040393 missense probably benign 0.00
R1460:Hecw2 UTSW 1 53813245 missense probably damaging 0.96
R1524:Hecw2 UTSW 1 53851618 missense probably damaging 1.00
R1533:Hecw2 UTSW 1 53926545 splice site probably null
R1828:Hecw2 UTSW 1 53926023 missense probably benign
R2170:Hecw2 UTSW 1 53942797 missense probably damaging 0.99
R2338:Hecw2 UTSW 1 53904422 missense possibly damaging 0.88
R3016:Hecw2 UTSW 1 53830680 missense probably damaging 1.00
R3872:Hecw2 UTSW 1 53832757 splice site probably benign
R3892:Hecw2 UTSW 1 53926121 missense probably benign 0.01
R4086:Hecw2 UTSW 1 53831656 missense probably damaging 1.00
R4247:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4248:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4249:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4545:Hecw2 UTSW 1 53813222 makesense probably null
R4805:Hecw2 UTSW 1 53840859 missense probably damaging 1.00
R4884:Hecw2 UTSW 1 53950841 missense probably benign 0.03
R4983:Hecw2 UTSW 1 53832671 missense probably benign 0.42
R5168:Hecw2 UTSW 1 53913300 missense probably damaging 1.00
R5482:Hecw2 UTSW 1 53926201 missense probably benign 0.09
R5549:Hecw2 UTSW 1 53925691 missense possibly damaging 0.91
R5623:Hecw2 UTSW 1 53832623 missense probably null 1.00
R5740:Hecw2 UTSW 1 53887603 missense probably benign 0.12
R5919:Hecw2 UTSW 1 53937090 missense probably damaging 0.99
R6058:Hecw2 UTSW 1 53923976 missense possibly damaging 0.67
R6460:Hecw2 UTSW 1 53868833 splice site probably null
R6875:Hecw2 UTSW 1 53937132 missense probably benign 0.01
R7097:Hecw2 UTSW 1 53865124 missense possibly damaging 0.88
R7131:Hecw2 UTSW 1 53865121 missense probably damaging 1.00
R7291:Hecw2 UTSW 1 53914594 missense probably damaging 1.00
R7401:Hecw2 UTSW 1 53904343 missense probably damaging 1.00
R7482:Hecw2 UTSW 1 54040470 missense probably damaging 0.99
R7501:Hecw2 UTSW 1 53913872 critical splice acceptor site probably null
R7520:Hecw2 UTSW 1 53926056 missense probably benign
R7611:Hecw2 UTSW 1 53913300 missense probably damaging 1.00
R8184:Hecw2 UTSW 1 54040387 missense probably benign 0.37
R8286:Hecw2 UTSW 1 53840769 missense probably damaging 1.00
R8300:Hecw2 UTSW 1 53887616 missense probably null 0.07
R8362:Hecw2 UTSW 1 54040491 start codon destroyed probably null 0.51
Z1177:Hecw2 UTSW 1 53923943 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGACCTGTGATTGAACTAGACTCC -3'
(R):5'- CCAGTGGGATATGGTGATCAAC -3'

Sequencing Primer
(F):5'- GTGATTGAACTAGACTCCCTGGAAC -3'
(R):5'- ACTGAGGCTAATCTTACAAACTTTC -3'
Posted On2016-03-01