Incidental Mutation 'R4834:Nup188'
ID373036
Institutional Source Beutler Lab
Gene Symbol Nup188
Ensembl Gene ENSMUSG00000052533
Gene Namenucleoporin 188
Synonyms
MMRRC Submission 041977-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R4834 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location30286397-30344266 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30339584 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1310 (L1310P)
Ref Sequence ENSEMBL: ENSMUSP00000065836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064447]
Predicted Effect probably damaging
Transcript: ENSMUST00000064447
AA Change: L1310P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000065836
Gene: ENSMUSG00000052533
AA Change: L1310P

DomainStartEndE-ValueType
Pfam:Nup188 31 941 9.3e-213 PFAM
low complexity region 1020 1035 N/A INTRINSIC
low complexity region 1307 1320 N/A INTRINSIC
low complexity region 1330 1360 N/A INTRINSIC
low complexity region 1696 1709 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133421
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex (NPC) is found on the nuclear envelope and forms a gateway that regulates the flow of proteins and RNAs between the cytoplasm and nucleoplasm. The NPC is comprised of approximately 30 distinct proteins collectively known as nucleoporins. Nucleoporins are pore-complex-specific glycoproteins which often have cytoplasmically oriented O-linked N-acetylglucosamine residues and numerous repeats of the pentapeptide sequence XFXFG. However, the nucleoporin protein encoded by this gene does not contain the typical FG repeat sequences found in most vertebrate nucleoporins. This nucleoporin is thought to form part of the scaffold for the central channel of the nuclear pore. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A C 9: 53,432,487 D146A possibly damaging Het
Acsl5 C A 19: 55,280,559 D217E probably benign Het
Acss3 A G 10: 107,084,805 probably null Het
Adam24 G A 8: 40,679,699 G69R probably damaging Het
Adgrg7 A T 16: 56,732,869 W622R probably damaging Het
Ankrd26 T C 6: 118,523,718 M931V probably benign Het
Ano8 C T 8: 71,484,295 V187M probably damaging Het
Ap3d1 A T 10: 80,719,726 C348S probably damaging Het
Apob T C 12: 8,014,101 V376A possibly damaging Het
Arhgap21 A T 2: 20,865,319 D925E probably damaging Het
Bmp6 T A 13: 38,485,841 V367E probably damaging Het
Bmp8b A T 4: 123,123,050 Q348L probably damaging Het
Ccr1l1 T C 9: 123,977,705 K235R probably damaging Het
Cd59a G A 2: 104,114,086 C93Y probably damaging Het
Clstn3 C T 6: 124,431,953 probably null Het
Col4a2 C A 8: 11,406,836 Y236* probably null Het
Csn1s2a T C 5: 87,781,778 F79L probably benign Het
Cyp4a10 A C 4: 115,525,808 Y360S probably damaging Het
Cyp4a29 A T 4: 115,249,670 I175F probably benign Het
D11Wsu47e C A 11: 113,688,979 T400K probably benign Het
Dck T A 5: 88,772,736 I105N probably damaging Het
Dicer1 A G 12: 104,696,591 L1577P probably benign Het
Dirc2 T A 16: 35,735,575 T172S probably benign Het
Disp2 G A 2: 118,792,504 S1239N probably benign Het
Dopey2 T C 16: 93,740,004 M1T probably null Het
E130308A19Rik T A 4: 59,690,317 C50* probably null Het
Elf2 A T 3: 51,277,221 D14E probably damaging Het
Epm2aip1 C T 9: 111,273,194 R412C probably benign Het
Foxm1 T C 6: 128,369,447 F114L probably damaging Het
Glcci1 C T 6: 8,582,601 R134* probably null Het
Gm996 T C 2: 25,579,518 E127G possibly damaging Het
Gspt1 T C 16: 11,222,717 K576E probably damaging Het
H2-M10.3 T C 17: 36,367,394 K180E probably benign Het
Hecw2 A T 1: 53,830,752 V1439E probably damaging Het
Hr T C 14: 70,559,922 S561P probably damaging Het
Hunk T C 16: 90,496,198 V456A probably benign Het
Il1rap T A 16: 26,676,935 D97E probably damaging Het
Inpp5d T G 1: 87,697,523 V474G possibly damaging Het
Itsn1 T A 16: 91,906,789 L87* probably null Het
Izumo3 T C 4: 92,146,971 D3G possibly damaging Het
Kifc2 T A 15: 76,661,311 M1K probably null Het
Krt8 T A 15: 101,998,821 I276F probably damaging Het
Ksr2 C A 5: 117,668,327 Q402K probably benign Het
Lama2 A G 10: 27,006,749 V2606A probably benign Het
Met A G 6: 17,491,413 H58R probably damaging Het
Mier3 C T 13: 111,715,109 Q542* probably null Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Msl3l2 C T 10: 56,115,559 R127C probably damaging Het
Naglu T C 11: 101,076,988 L588P probably benign Het
Nf1 T C 11: 79,546,297 L2013P probably damaging Het
Nid1 A G 13: 13,508,823 Y1162C probably damaging Het
Nlrc5 G T 8: 94,505,485 R1313L probably benign Het
Nrg1 A G 8: 31,917,719 V162A probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1310 A G 2: 112,008,931 L85P probably damaging Het
Olfr290 T G 7: 84,916,283 F168C probably damaging Het
Olfr305 G A 7: 86,363,744 L198F probably benign Het
Pbk T A 14: 65,815,284 L192* probably null Het
Pcdhga4 T C 18: 37,685,437 I13T probably benign Het
Peg10 A T 6: 4,754,294 probably benign Het
Polq T A 16: 37,027,814 V261D probably damaging Het
Ppp2r5b T A 19: 6,230,510 T313S possibly damaging Het
Ptk2 A T 15: 73,216,096 probably null Het
Ptpn7 T A 1: 135,137,880 probably null Het
Rab11fip1 A G 8: 27,153,083 S563P probably damaging Het
Scn1a A T 2: 66,328,522 C351* probably null Het
Slc10a5 A T 3: 10,334,799 V267D probably damaging Het
Slc37a2 T A 9: 37,235,108 M368L probably damaging Het
Slc6a20b T A 9: 123,596,048 T585S probably benign Het
Srcap T C 7: 127,557,610 probably null Het
Tbx18 T C 9: 87,727,449 M178V possibly damaging Het
Tmprss11b C A 5: 86,663,559 C172F probably damaging Het
Traf5 T C 1: 192,066,898 Q91R probably benign Het
Trappc8 A T 18: 20,825,065 Y1248N probably damaging Het
Trpa1 A G 1: 14,896,523 L539S possibly damaging Het
Tyrp1 T A 4: 80,846,596 Y3* probably null Het
Ubr7 A T 12: 102,761,502 K94N probably damaging Het
Ugt2a1 C A 5: 87,486,035 probably null Het
Unc50 T A 1: 37,432,629 I120K probably damaging Het
Usp28 T C 9: 49,001,536 V29A probably damaging Het
Usp9y A G Y: 1,317,002 I1849T probably benign Het
Vmn2r102 T A 17: 19,677,941 V406E probably damaging Het
Vmn2r4 G A 3: 64,410,063 R85W probably benign Het
Xirp2 A G 2: 67,516,406 D2997G probably benign Het
Zc2hc1c A T 12: 85,290,208 E213V probably damaging Het
Zfp420 C T 7: 29,874,334 probably benign Het
Zfp641 C T 15: 98,293,704 E34K probably damaging Het
Other mutations in Nup188
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Nup188 APN 2 30333400 missense probably damaging 0.98
IGL01599:Nup188 APN 2 30327525 missense possibly damaging 0.92
IGL01938:Nup188 APN 2 30329359 missense probably benign
IGL01973:Nup188 APN 2 30339850 missense possibly damaging 0.95
IGL02157:Nup188 APN 2 30329373 nonsense probably null
IGL02221:Nup188 APN 2 30330641 missense possibly damaging 0.75
IGL02277:Nup188 APN 2 30326511 missense possibly damaging 0.95
IGL02335:Nup188 APN 2 30323636 critical splice donor site probably null
IGL02986:Nup188 APN 2 30307633 unclassified probably null
IGL03029:Nup188 APN 2 30322580 splice site probably benign
IGL03194:Nup188 APN 2 30304334 missense possibly damaging 0.95
IGL03370:Nup188 APN 2 30340641 missense possibly damaging 0.52
P0027:Nup188 UTSW 2 30322681 missense probably damaging 0.99
R0006:Nup188 UTSW 2 30322023 missense probably benign 0.27
R0360:Nup188 UTSW 2 30326479 missense probably null 0.93
R0373:Nup188 UTSW 2 30330988 missense probably damaging 1.00
R0645:Nup188 UTSW 2 30343466 unclassified probably null
R1411:Nup188 UTSW 2 30343795 missense probably benign 0.01
R1670:Nup188 UTSW 2 30340655 missense probably benign 0.19
R2034:Nup188 UTSW 2 30310085 unclassified probably benign
R2113:Nup188 UTSW 2 30304101 nonsense probably null
R2142:Nup188 UTSW 2 30336706 missense possibly damaging 0.49
R2221:Nup188 UTSW 2 30336924 splice site probably benign
R2567:Nup188 UTSW 2 30341782 missense possibly damaging 0.53
R2964:Nup188 UTSW 2 30325346 missense probably damaging 0.98
R4006:Nup188 UTSW 2 30309878 missense probably damaging 0.99
R4007:Nup188 UTSW 2 30309878 missense probably damaging 0.99
R4079:Nup188 UTSW 2 30309878 missense probably damaging 0.99
R4480:Nup188 UTSW 2 30322129 intron probably benign
R4628:Nup188 UTSW 2 30329346 missense probably damaging 1.00
R4687:Nup188 UTSW 2 30330633 missense probably benign 0.01
R4814:Nup188 UTSW 2 30326511 missense possibly damaging 0.95
R5038:Nup188 UTSW 2 30309220 missense probably damaging 0.98
R5056:Nup188 UTSW 2 30304131 missense probably damaging 0.98
R5124:Nup188 UTSW 2 30330935 missense probably damaging 1.00
R5256:Nup188 UTSW 2 30330749 missense probably damaging 1.00
R5284:Nup188 UTSW 2 30330635 missense probably damaging 1.00
R5548:Nup188 UTSW 2 30326493 missense probably damaging 0.99
R5560:Nup188 UTSW 2 30309885 missense probably damaging 0.99
R5668:Nup188 UTSW 2 30336324 missense probably damaging 1.00
R5769:Nup188 UTSW 2 30330735 missense probably benign 0.34
R5773:Nup188 UTSW 2 30322196 missense possibly damaging 0.92
R5774:Nup188 UTSW 2 30301048 missense probably damaging 1.00
R5827:Nup188 UTSW 2 30339847 missense probably damaging 1.00
R5919:Nup188 UTSW 2 30339894 missense probably damaging 1.00
R5923:Nup188 UTSW 2 30304090 missense probably benign
R6185:Nup188 UTSW 2 30341710 missense probably damaging 0.97
R6457:Nup188 UTSW 2 30322187 missense probably damaging 0.98
R6529:Nup188 UTSW 2 30326454 missense possibly damaging 0.95
R7002:Nup188 UTSW 2 30323568 missense probably damaging 0.99
R7195:Nup188 UTSW 2 30341830 critical splice donor site probably null
R7214:Nup188 UTSW 2 30307554 missense possibly damaging 0.71
R7345:Nup188 UTSW 2 30340601 missense probably benign 0.09
T0722:Nup188 UTSW 2 30322681 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATGGCCCCAGACACACTTG -3'
(R):5'- ATGGAGCCCACAAAGATTTGC -3'

Sequencing Primer
(F):5'- ACACTTGTGAGAGGATCCCTG -3'
(R):5'- CCACAAAGATTTGCCCAGGG -3'
Posted On2016-03-01