Incidental Mutation 'R4834:Xirp2'
ID373038
Institutional Source Beutler Lab
Gene Symbol Xirp2
Ensembl Gene ENSMUSG00000027022
Gene Namexin actin-binding repeat containing 2
Synonyms2310003D02Rik, 2310008C07Rik, myomaxin, Cmya3, A530024P18Rik, mXin beta
MMRRC Submission 041977-MU
Accession Numbers

Genbank: NM_001024618, NM_001083919; MGI: 2685198

Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R4834 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location67446002-67526614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67516406 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2997 (D2997G)
Ref Sequence ENSEMBL: ENSMUSP00000107966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028410] [ENSMUST00000112347]
Predicted Effect probably benign
Transcript: ENSMUST00000028410
AA Change: D2997G

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028410
Gene: ENSMUSG00000027022
AA Change: D2997G

DomainStartEndE-ValueType
low complexity region 176 188 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
Pfam:Xin 343 358 4e-9 PFAM
Pfam:Xin 384 398 7.6e-10 PFAM
Pfam:Xin 420 435 6.4e-9 PFAM
Pfam:Xin 458 473 5.3e-9 PFAM
Pfam:Xin 536 551 4.1e-12 PFAM
Pfam:Xin 574 588 2.1e-8 PFAM
Pfam:Xin 609 623 6e-9 PFAM
Pfam:Xin 642 656 5.6e-8 PFAM
Pfam:Xin 679 693 5.9e-8 PFAM
Pfam:Xin 784 799 1.1e-10 PFAM
Pfam:Xin 822 837 3.9e-11 PFAM
Pfam:Xin 861 875 8.6e-12 PFAM
Pfam:Xin 894 909 2.8e-10 PFAM
Pfam:Xin 1006 1021 3.1e-9 PFAM
Pfam:Xin 1079 1094 6.7e-10 PFAM
Pfam:Xin 1117 1132 1.5e-10 PFAM
Pfam:Xin 1154 1169 2.4e-8 PFAM
Pfam:Xin 1256 1271 4.6e-8 PFAM
Pfam:Xin 1292 1305 1.6e-8 PFAM
low complexity region 1314 1325 N/A INTRINSIC
low complexity region 1547 1559 N/A INTRINSIC
coiled coil region 1683 1704 N/A INTRINSIC
low complexity region 1862 1871 N/A INTRINSIC
low complexity region 2031 2043 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2087 2093 N/A INTRINSIC
low complexity region 2105 2123 N/A INTRINSIC
low complexity region 2159 2177 N/A INTRINSIC
coiled coil region 2288 2311 N/A INTRINSIC
coiled coil region 2738 2767 N/A INTRINSIC
low complexity region 2794 2804 N/A INTRINSIC
low complexity region 2906 2919 N/A INTRINSIC
LIM 3256 3308 4.45e-12 SMART
low complexity region 3356 3367 N/A INTRINSIC
low complexity region 3549 3565 N/A INTRINSIC
low complexity region 3614 3625 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112347
AA Change: D2997G

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107966
Gene: ENSMUSG00000027022
AA Change: D2997G

DomainStartEndE-ValueType
low complexity region 176 188 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
Pfam:Xin 343 358 4.3e-8 PFAM
Pfam:Xin 383 398 6.9e-9 PFAM
Pfam:Xin 420 435 1.8e-8 PFAM
Pfam:Xin 458 473 6.9e-8 PFAM
Pfam:Xin 536 551 2.8e-10 PFAM
Pfam:Xin 608 623 2.4e-8 PFAM
Pfam:Xin 642 657 1.7e-7 PFAM
Pfam:Xin 784 799 3.5e-9 PFAM
Pfam:Xin 822 837 8.9e-10 PFAM
Pfam:Xin 861 876 3.9e-10 PFAM
Pfam:Xin 894 909 5.4e-9 PFAM
Pfam:Xin 1006 1021 6.2e-8 PFAM
Pfam:Xin 1079 1094 2.4e-8 PFAM
Pfam:Xin 1117 1132 9.5e-9 PFAM
Pfam:Xin 1291 1306 5.8e-8 PFAM
low complexity region 1314 1325 N/A INTRINSIC
low complexity region 1547 1559 N/A INTRINSIC
coiled coil region 1683 1704 N/A INTRINSIC
low complexity region 1862 1871 N/A INTRINSIC
low complexity region 2031 2043 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2087 2093 N/A INTRINSIC
low complexity region 2105 2123 N/A INTRINSIC
low complexity region 2159 2177 N/A INTRINSIC
coiled coil region 2288 2311 N/A INTRINSIC
coiled coil region 2738 2767 N/A INTRINSIC
low complexity region 2794 2804 N/A INTRINSIC
low complexity region 2906 2919 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142314
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype Strain: 4947971; 4453315
Lethality: D3-D21
PHENOTYPE: Homozygous null mice have an abnormal heart shape, ventricular septal defects, a failure of mature intercalated disc formation, severe growth retardation, and postnatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A C 9: 53,432,487 D146A possibly damaging Het
Acsl5 C A 19: 55,280,559 D217E probably benign Het
Acss3 A G 10: 107,084,805 probably null Het
Adam24 G A 8: 40,679,699 G69R probably damaging Het
Adgrg7 A T 16: 56,732,869 W622R probably damaging Het
Ankrd26 T C 6: 118,523,718 M931V probably benign Het
Ano8 C T 8: 71,484,295 V187M probably damaging Het
Ap3d1 A T 10: 80,719,726 C348S probably damaging Het
Apob T C 12: 8,014,101 V376A possibly damaging Het
Arhgap21 A T 2: 20,865,319 D925E probably damaging Het
Bmp6 T A 13: 38,485,841 V367E probably damaging Het
Bmp8b A T 4: 123,123,050 Q348L probably damaging Het
Ccr1l1 T C 9: 123,977,705 K235R probably damaging Het
Cd59a G A 2: 104,114,086 C93Y probably damaging Het
Clstn3 C T 6: 124,431,953 probably null Het
Col4a2 C A 8: 11,406,836 Y236* probably null Het
Csn1s2a T C 5: 87,781,778 F79L probably benign Het
Cyp4a10 A C 4: 115,525,808 Y360S probably damaging Het
Cyp4a29 A T 4: 115,249,670 I175F probably benign Het
D11Wsu47e C A 11: 113,688,979 T400K probably benign Het
Dck T A 5: 88,772,736 I105N probably damaging Het
Dicer1 A G 12: 104,696,591 L1577P probably benign Het
Dirc2 T A 16: 35,735,575 T172S probably benign Het
Disp2 G A 2: 118,792,504 S1239N probably benign Het
Dopey2 T C 16: 93,740,004 M1T probably null Het
E130308A19Rik T A 4: 59,690,317 C50* probably null Het
Elf2 A T 3: 51,277,221 D14E probably damaging Het
Epm2aip1 C T 9: 111,273,194 R412C probably benign Het
Foxm1 T C 6: 128,369,447 F114L probably damaging Het
Glcci1 C T 6: 8,582,601 R134* probably null Het
Gm996 T C 2: 25,579,518 E127G possibly damaging Het
Gspt1 T C 16: 11,222,717 K576E probably damaging Het
H2-M10.3 T C 17: 36,367,394 K180E probably benign Het
Hecw2 A T 1: 53,830,752 V1439E probably damaging Het
Hr T C 14: 70,559,922 S561P probably damaging Het
Hunk T C 16: 90,496,198 V456A probably benign Het
Il1rap T A 16: 26,676,935 D97E probably damaging Het
Inpp5d T G 1: 87,697,523 V474G possibly damaging Het
Itsn1 T A 16: 91,906,789 L87* probably null Het
Izumo3 T C 4: 92,146,971 D3G possibly damaging Het
Kifc2 T A 15: 76,661,311 M1K probably null Het
Krt8 T A 15: 101,998,821 I276F probably damaging Het
Ksr2 C A 5: 117,668,327 Q402K probably benign Het
Lama2 A G 10: 27,006,749 V2606A probably benign Het
Met A G 6: 17,491,413 H58R probably damaging Het
Mier3 C T 13: 111,715,109 Q542* probably null Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Msl3l2 C T 10: 56,115,559 R127C probably damaging Het
Naglu T C 11: 101,076,988 L588P probably benign Het
Nf1 T C 11: 79,546,297 L2013P probably damaging Het
Nid1 A G 13: 13,508,823 Y1162C probably damaging Het
Nlrc5 G T 8: 94,505,485 R1313L probably benign Het
Nrg1 A G 8: 31,917,719 V162A probably benign Het
Nup188 T C 2: 30,339,584 L1310P probably damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1310 A G 2: 112,008,931 L85P probably damaging Het
Olfr290 T G 7: 84,916,283 F168C probably damaging Het
Olfr305 G A 7: 86,363,744 L198F probably benign Het
Pbk T A 14: 65,815,284 L192* probably null Het
Pcdhga4 T C 18: 37,685,437 I13T probably benign Het
Peg10 A T 6: 4,754,294 probably benign Het
Polq T A 16: 37,027,814 V261D probably damaging Het
Ppp2r5b T A 19: 6,230,510 T313S possibly damaging Het
Ptk2 A T 15: 73,216,096 probably null Het
Ptpn7 T A 1: 135,137,880 probably null Het
Rab11fip1 A G 8: 27,153,083 S563P probably damaging Het
Scn1a A T 2: 66,328,522 C351* probably null Het
Slc10a5 A T 3: 10,334,799 V267D probably damaging Het
Slc37a2 T A 9: 37,235,108 M368L probably damaging Het
Slc6a20b T A 9: 123,596,048 T585S probably benign Het
Srcap T C 7: 127,557,610 probably null Het
Tbx18 T C 9: 87,727,449 M178V possibly damaging Het
Tmprss11b C A 5: 86,663,559 C172F probably damaging Het
Traf5 T C 1: 192,066,898 Q91R probably benign Het
Trappc8 A T 18: 20,825,065 Y1248N probably damaging Het
Trpa1 A G 1: 14,896,523 L539S possibly damaging Het
Tyrp1 T A 4: 80,846,596 Y3* probably null Het
Ubr7 A T 12: 102,761,502 K94N probably damaging Het
Ugt2a1 C A 5: 87,486,035 probably null Het
Unc50 T A 1: 37,432,629 I120K probably damaging Het
Usp28 T C 9: 49,001,536 V29A probably damaging Het
Usp9y A G Y: 1,317,002 I1849T probably benign Het
Vmn2r102 T A 17: 19,677,941 V406E probably damaging Het
Vmn2r4 G A 3: 64,410,063 R85W probably benign Het
Zc2hc1c A T 12: 85,290,208 E213V probably damaging Het
Zfp420 C T 7: 29,874,334 probably benign Het
Zfp641 C T 15: 98,293,704 E34K probably damaging Het
Other mutations in Xirp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Xirp2 APN 2 67513375 missense probably benign 0.37
IGL00336:Xirp2 APN 2 67512598 missense possibly damaging 0.93
IGL00596:Xirp2 APN 2 67514882 missense probably benign 0.08
IGL00862:Xirp2 APN 2 67516903 missense probably benign 0.00
IGL01124:Xirp2 APN 2 67508615 missense probably damaging 0.99
IGL01289:Xirp2 APN 2 67513181 missense probably damaging 0.99
IGL01293:Xirp2 APN 2 67515184 missense possibly damaging 0.51
IGL01372:Xirp2 APN 2 67513990 missense possibly damaging 0.93
IGL01385:Xirp2 APN 2 67509677 missense probably damaging 0.99
IGL01411:Xirp2 APN 2 67514083 missense probably benign 0.00
IGL01413:Xirp2 APN 2 67509926 missense probably damaging 1.00
IGL01551:Xirp2 APN 2 67513505 missense probably benign
IGL01672:Xirp2 APN 2 67508502 missense probably benign
IGL01724:Xirp2 APN 2 67526067 missense probably benign
IGL01739:Xirp2 APN 2 67515138 missense probably benign 0.15
IGL01807:Xirp2 APN 2 67515031 missense probably benign
IGL02006:Xirp2 APN 2 67511962 missense possibly damaging 0.85
IGL02030:Xirp2 APN 2 67508981 missense probably benign 0.06
IGL02066:Xirp2 APN 2 67526071 missense probably benign
IGL02138:Xirp2 APN 2 67516956 missense probably benign 0.15
IGL02250:Xirp2 APN 2 67514012 missense probably benign 0.03
IGL02265:Xirp2 APN 2 67517150 missense possibly damaging 0.94
IGL02274:Xirp2 APN 2 67508651 missense probably benign 0.12
IGL02322:Xirp2 APN 2 67508738 missense probably benign 0.00
IGL02327:Xirp2 APN 2 67510100 missense probably damaging 1.00
IGL02378:Xirp2 APN 2 67513768 missense probably benign 0.00
IGL02492:Xirp2 APN 2 67516167 missense probably damaging 0.99
IGL02549:Xirp2 APN 2 67513102 missense probably benign 0.03
IGL02578:Xirp2 APN 2 67511247 missense probably damaging 0.96
IGL02635:Xirp2 APN 2 67507910 missense possibly damaging 0.86
IGL02654:Xirp2 APN 2 67514671 missense possibly damaging 0.86
IGL02663:Xirp2 APN 2 67509458 missense possibly damaging 0.92
IGL02795:Xirp2 APN 2 67509136 missense probably damaging 1.00
IGL02934:Xirp2 APN 2 67515676 missense probably benign 0.33
IGL03003:Xirp2 APN 2 67515562 missense possibly damaging 0.93
IGL03069:Xirp2 APN 2 67509532 missense possibly damaging 0.91
IGL03286:Xirp2 APN 2 67516310 missense probably damaging 0.99
IGL03326:Xirp2 APN 2 67482246 missense probably benign 0.01
IGL03381:Xirp2 APN 2 67514226 missense probably benign 0.34
IGL03394:Xirp2 APN 2 67515194 missense probably damaging 0.99
3-1:Xirp2 UTSW 2 67508198 missense possibly damaging 0.95
H8562:Xirp2 UTSW 2 67515457 missense probably benign
PIT4142001:Xirp2 UTSW 2 67519362 splice site probably benign
PIT4260001:Xirp2 UTSW 2 67511597 missense possibly damaging 0.96
PIT4445001:Xirp2 UTSW 2 67509772 missense possibly damaging 0.84
PIT4531001:Xirp2 UTSW 2 67515482 missense possibly damaging 0.73
R0015:Xirp2 UTSW 2 67510899 nonsense probably null
R0063:Xirp2 UTSW 2 67509083 missense probably damaging 0.99
R0063:Xirp2 UTSW 2 67509083 missense probably damaging 0.99
R0066:Xirp2 UTSW 2 67512140 missense possibly damaging 0.85
R0109:Xirp2 UTSW 2 67519278 missense probably damaging 1.00
R0111:Xirp2 UTSW 2 67508378 missense probably damaging 0.99
R0115:Xirp2 UTSW 2 67509909 missense possibly damaging 0.92
R0117:Xirp2 UTSW 2 67517120 missense possibly damaging 0.94
R0133:Xirp2 UTSW 2 67517124 missense probably benign
R0282:Xirp2 UTSW 2 67513380 missense probably damaging 0.96
R0463:Xirp2 UTSW 2 67514918 missense probably benign 0.02
R0481:Xirp2 UTSW 2 67509909 missense possibly damaging 0.92
R0488:Xirp2 UTSW 2 67514821 missense possibly damaging 0.90
R0548:Xirp2 UTSW 2 67514414 missense probably benign 0.00
R0557:Xirp2 UTSW 2 67516351 missense probably benign 0.33
R0582:Xirp2 UTSW 2 67508866 missense probably benign
R0723:Xirp2 UTSW 2 67512215 missense probably damaging 0.98
R0835:Xirp2 UTSW 2 67507910 missense possibly damaging 0.86
R1160:Xirp2 UTSW 2 67509887 missense possibly damaging 0.92
R1189:Xirp2 UTSW 2 67513461 missense probably damaging 0.96
R1474:Xirp2 UTSW 2 67525067 missense probably benign 0.00
R1513:Xirp2 UTSW 2 67511530 missense probably benign 0.00
R1514:Xirp2 UTSW 2 67514323 nonsense probably null
R1519:Xirp2 UTSW 2 67515679 missense probably benign 0.44
R1532:Xirp2 UTSW 2 67513939 missense probably benign 0.00
R1537:Xirp2 UTSW 2 67510013 missense probably damaging 0.98
R1541:Xirp2 UTSW 2 67512290 missense possibly damaging 0.70
R1543:Xirp2 UTSW 2 67508039 missense probably benign
R1607:Xirp2 UTSW 2 67510295 nonsense probably null
R1620:Xirp2 UTSW 2 67510835 missense probably damaging 0.98
R1709:Xirp2 UTSW 2 67509871 missense probably benign 0.33
R1713:Xirp2 UTSW 2 67512418 missense probably benign 0.25
R1828:Xirp2 UTSW 2 67515238 missense possibly damaging 0.86
R1834:Xirp2 UTSW 2 67511140 missense probably damaging 0.99
R1905:Xirp2 UTSW 2 67516356 missense probably damaging 0.98
R1907:Xirp2 UTSW 2 67516356 missense probably damaging 0.98
R1943:Xirp2 UTSW 2 67512615 missense probably benign 0.34
R1971:Xirp2 UTSW 2 67511695 missense possibly damaging 0.48
R1998:Xirp2 UTSW 2 67509049 missense probably damaging 0.97
R2075:Xirp2 UTSW 2 67510201 missense probably benign 0.33
R2132:Xirp2 UTSW 2 67508048 missense possibly damaging 0.72
R2175:Xirp2 UTSW 2 67509914 missense probably damaging 0.99
R2310:Xirp2 UTSW 2 67526247 missense probably benign 0.19
R2338:Xirp2 UTSW 2 67510770 missense probably damaging 0.98
R2426:Xirp2 UTSW 2 67514471 missense probably benign 0.02
R2483:Xirp2 UTSW 2 67524992 missense probably benign
R3084:Xirp2 UTSW 2 67509049 missense probably damaging 0.97
R3113:Xirp2 UTSW 2 67510147 missense probably benign 0.33
R3903:Xirp2 UTSW 2 67508036 missense probably benign 0.40
R3916:Xirp2 UTSW 2 67511422 missense probably benign 0.25
R3928:Xirp2 UTSW 2 67511669 missense possibly damaging 0.85
R4025:Xirp2 UTSW 2 67511402 missense probably benign 0.12
R4135:Xirp2 UTSW 2 67525397 missense probably benign 0.00
R4223:Xirp2 UTSW 2 67516493 missense possibly damaging 0.66
R4257:Xirp2 UTSW 2 67516039 missense probably benign 0.31
R4499:Xirp2 UTSW 2 67513438 missense probably benign 0.08
R4577:Xirp2 UTSW 2 67513897 missense probably damaging 0.99
R4739:Xirp2 UTSW 2 67519265 missense probably damaging 0.99
R4758:Xirp2 UTSW 2 67516535 missense probably damaging 0.98
R4855:Xirp2 UTSW 2 67511064 missense possibly damaging 0.96
R4923:Xirp2 UTSW 2 67512893 missense probably benign
R4936:Xirp2 UTSW 2 67509819 missense possibly damaging 0.85
R5032:Xirp2 UTSW 2 67525670 missense possibly damaging 0.84
R5049:Xirp2 UTSW 2 67517134 missense probably benign 0.03
R5077:Xirp2 UTSW 2 67514477 missense probably benign
R5090:Xirp2 UTSW 2 67525470 missense possibly damaging 0.83
R5107:Xirp2 UTSW 2 67509710 missense probably damaging 0.99
R5107:Xirp2 UTSW 2 67511861 missense probably damaging 1.00
R5187:Xirp2 UTSW 2 67515367 missense probably benign 0.01
R5241:Xirp2 UTSW 2 67482360 nonsense probably null
R5307:Xirp2 UTSW 2 67511162 missense probably damaging 0.99
R5342:Xirp2 UTSW 2 67513461 missense probably damaging 0.96
R5370:Xirp2 UTSW 2 67512152 missense possibly damaging 0.72
R5375:Xirp2 UTSW 2 67511906 missense probably damaging 0.99
R5407:Xirp2 UTSW 2 67510969 missense probably benign 0.33
R5514:Xirp2 UTSW 2 67505121 missense probably benign 0.03
R5531:Xirp2 UTSW 2 67515302 missense probably benign 0.42
R5590:Xirp2 UTSW 2 67514035 missense probably benign 0.23
R5646:Xirp2 UTSW 2 67510790 missense probably damaging 0.99
R5649:Xirp2 UTSW 2 67516895 missense probably benign 0.00
R5686:Xirp2 UTSW 2 67482298 missense probably damaging 0.99
R5761:Xirp2 UTSW 2 67510967 missense probably benign 0.00
R5777:Xirp2 UTSW 2 67510004 missense possibly damaging 0.92
R5785:Xirp2 UTSW 2 67509662 missense probably damaging 0.96
R5843:Xirp2 UTSW 2 67476785 start gained probably benign
R5846:Xirp2 UTSW 2 67509243 missense probably damaging 0.98
R5875:Xirp2 UTSW 2 67505080 missense probably benign 0.00
R5896:Xirp2 UTSW 2 67508698 missense probably benign 0.32
R5896:Xirp2 UTSW 2 67509946 missense possibly damaging 0.91
R5901:Xirp2 UTSW 2 67513066 missense possibly damaging 0.91
R5934:Xirp2 UTSW 2 67524804 missense possibly damaging 0.92
R5950:Xirp2 UTSW 2 67511320 missense possibly damaging 0.95
R5996:Xirp2 UTSW 2 67511650 missense possibly damaging 0.91
R6013:Xirp2 UTSW 2 67510943 missense possibly damaging 0.48
R6048:Xirp2 UTSW 2 67508243 missense possibly damaging 0.96
R6111:Xirp2 UTSW 2 67511817 missense possibly damaging 0.86
R6180:Xirp2 UTSW 2 67505577 critical splice donor site probably null
R6342:Xirp2 UTSW 2 67511650 missense possibly damaging 0.91
R6346:Xirp2 UTSW 2 67516081 missense probably benign 0.00
R6603:Xirp2 UTSW 2 67516544 missense probably benign
R6604:Xirp2 UTSW 2 67509845 missense possibly damaging 0.86
R6669:Xirp2 UTSW 2 67513355 missense possibly damaging 0.78
R6701:Xirp2 UTSW 2 67516225 missense possibly damaging 0.94
R6726:Xirp2 UTSW 2 67512868 missense possibly damaging 0.88
R6833:Xirp2 UTSW 2 67509950 missense probably benign 0.12
R6897:Xirp2 UTSW 2 67508567 missense probably damaging 1.00
R6933:Xirp2 UTSW 2 67514857 missense probably benign 0.34
R7020:Xirp2 UTSW 2 67525569 missense probably benign
R7042:Xirp2 UTSW 2 67513289 missense probably benign 0.12
R7060:Xirp2 UTSW 2 67515608 missense probably damaging 1.00
R7179:Xirp2 UTSW 2 67509833 missense probably benign 0.00
R7229:Xirp2 UTSW 2 67525551 missense probably damaging 0.99
R7253:Xirp2 UTSW 2 67513482 missense probably benign
R7284:Xirp2 UTSW 2 67516829 missense probably benign
R7450:Xirp2 UTSW 2 67509815 missense possibly damaging 0.86
R7476:Xirp2 UTSW 2 67510634 missense probably benign 0.01
R7489:Xirp2 UTSW 2 67525560 missense possibly damaging 0.83
R7513:Xirp2 UTSW 2 67510764 missense possibly damaging 0.86
R7549:Xirp2 UTSW 2 67508897 missense possibly damaging 0.91
R7563:Xirp2 UTSW 2 67509901 missense probably damaging 0.99
R7567:Xirp2 UTSW 2 67515982 missense probably benign 0.02
R7577:Xirp2 UTSW 2 67514965 missense possibly damaging 0.65
R7597:Xirp2 UTSW 2 67525755 missense possibly damaging 0.84
R7610:Xirp2 UTSW 2 67525962 missense possibly damaging 0.92
R7613:Xirp2 UTSW 2 67514498 missense probably benign 0.00
R7669:Xirp2 UTSW 2 67512177 missense probably benign 0.00
R7670:Xirp2 UTSW 2 67510573 missense possibly damaging 0.91
R7673:Xirp2 UTSW 2 67517087 missense probably damaging 1.00
R7682:Xirp2 UTSW 2 67508849 missense probably damaging 0.99
R7755:Xirp2 UTSW 2 67515182 missense probably benign
R7805:Xirp2 UTSW 2 67509981 missense probably benign 0.23
R7815:Xirp2 UTSW 2 67509412 missense probably damaging 1.00
R7823:Xirp2 UTSW 2 67511774 missense probably damaging 1.00
RF035:Xirp2 UTSW 2 67525544 utr 3 prime probably benign
RF040:Xirp2 UTSW 2 67525544 utr 3 prime probably benign
X0063:Xirp2 UTSW 2 67516123 missense probably benign 0.04
X0065:Xirp2 UTSW 2 67515118 missense probably benign 0.34
Z1088:Xirp2 UTSW 2 67513321 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGGCACCATCCCTTGTTCAC -3'
(R):5'- GCCATTCAGAAAACGTTCAGCC -3'

Sequencing Primer
(F):5'- AGGTTGTCATGTCTCCAG -3'
(R):5'- TCAGAAAACGTTCAGCCCTTTG -3'
Posted On2016-03-01