Incidental Mutation 'R4834:Tyrp1'
ID373047
Institutional Source Beutler Lab
Gene Symbol Tyrp1
Ensembl Gene ENSMUSG00000005994
Gene Nametyrosinase-related protein 1
SynonymsTyrp, isa, Oca3, TRP1, TRP-1
MMRRC Submission 041977-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R4834 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location80834123-80851719 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 80846596 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 3 (Y3*)
Ref Sequence ENSEMBL: ENSMUSP00000119167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006151] [ENSMUST00000102831] [ENSMUST00000133932]
Predicted Effect probably null
Transcript: ENSMUST00000006151
AA Change: Y369*
SMART Domains Protein: ENSMUSP00000006151
Gene: ENSMUSG00000005994
AA Change: Y369*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Tyrosinase 182 417 1.7e-37 PFAM
transmembrane domain 479 501 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102831
AA Change: Y369*
SMART Domains Protein: ENSMUSP00000099895
Gene: ENSMUSG00000005994
AA Change: Y369*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Tyrosinase 182 417 4.9e-38 PFAM
transmembrane domain 479 501 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000133932
AA Change: Y3*
SMART Domains Protein: ENSMUSP00000119167
Gene: ENSMUSG00000005994
AA Change: Y3*

DomainStartEndE-ValueType
Pfam:Tyrosinase 1 51 1e-12 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a melanosomal enzyme that belongs to the tyrosinase family and plays an important role in the melanin biosynthetic pathway. Defects in this gene are the cause of rufous oculocutaneous albinism and oculocutaneous albinism type III. [provided by RefSeq, Mar 2009]
PHENOTYPE: The major influence of mutations at this locus is to change eumelanin from a black to a brown pigment in the coat and eyes in varying degrees. Semidominant mutants result in melanocyte degeneration causing reduced pigmentation and progressive hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A C 9: 53,432,487 D146A possibly damaging Het
Acsl5 C A 19: 55,280,559 D217E probably benign Het
Acss3 A G 10: 107,084,805 probably null Het
Adam24 G A 8: 40,679,699 G69R probably damaging Het
Adgrg7 A T 16: 56,732,869 W622R probably damaging Het
Ankrd26 T C 6: 118,523,718 M931V probably benign Het
Ano8 C T 8: 71,484,295 V187M probably damaging Het
Ap3d1 A T 10: 80,719,726 C348S probably damaging Het
Apob T C 12: 8,014,101 V376A possibly damaging Het
Arhgap21 A T 2: 20,865,319 D925E probably damaging Het
Bmp6 T A 13: 38,485,841 V367E probably damaging Het
Bmp8b A T 4: 123,123,050 Q348L probably damaging Het
Ccr1l1 T C 9: 123,977,705 K235R probably damaging Het
Cd59a G A 2: 104,114,086 C93Y probably damaging Het
Clstn3 C T 6: 124,431,953 probably null Het
Col4a2 C A 8: 11,406,836 Y236* probably null Het
Csn1s2a T C 5: 87,781,778 F79L probably benign Het
Cyp4a10 A C 4: 115,525,808 Y360S probably damaging Het
Cyp4a29 A T 4: 115,249,670 I175F probably benign Het
D11Wsu47e C A 11: 113,688,979 T400K probably benign Het
Dck T A 5: 88,772,736 I105N probably damaging Het
Dicer1 A G 12: 104,696,591 L1577P probably benign Het
Dirc2 T A 16: 35,735,575 T172S probably benign Het
Disp2 G A 2: 118,792,504 S1239N probably benign Het
Dopey2 T C 16: 93,740,004 M1T probably null Het
E130308A19Rik T A 4: 59,690,317 C50* probably null Het
Elf2 A T 3: 51,277,221 D14E probably damaging Het
Epm2aip1 C T 9: 111,273,194 R412C probably benign Het
Foxm1 T C 6: 128,369,447 F114L probably damaging Het
Glcci1 C T 6: 8,582,601 R134* probably null Het
Gm996 T C 2: 25,579,518 E127G possibly damaging Het
Gspt1 T C 16: 11,222,717 K576E probably damaging Het
H2-M10.3 T C 17: 36,367,394 K180E probably benign Het
Hecw2 A T 1: 53,830,752 V1439E probably damaging Het
Hr T C 14: 70,559,922 S561P probably damaging Het
Hunk T C 16: 90,496,198 V456A probably benign Het
Il1rap T A 16: 26,676,935 D97E probably damaging Het
Inpp5d T G 1: 87,697,523 V474G possibly damaging Het
Itsn1 T A 16: 91,906,789 L87* probably null Het
Izumo3 T C 4: 92,146,971 D3G possibly damaging Het
Kifc2 T A 15: 76,661,311 M1K probably null Het
Krt8 T A 15: 101,998,821 I276F probably damaging Het
Ksr2 C A 5: 117,668,327 Q402K probably benign Het
Lama2 A G 10: 27,006,749 V2606A probably benign Het
Met A G 6: 17,491,413 H58R probably damaging Het
Mier3 C T 13: 111,715,109 Q542* probably null Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Msl3l2 C T 10: 56,115,559 R127C probably damaging Het
Naglu T C 11: 101,076,988 L588P probably benign Het
Nf1 T C 11: 79,546,297 L2013P probably damaging Het
Nid1 A G 13: 13,508,823 Y1162C probably damaging Het
Nlrc5 G T 8: 94,505,485 R1313L probably benign Het
Nrg1 A G 8: 31,917,719 V162A probably benign Het
Nup188 T C 2: 30,339,584 L1310P probably damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1310 A G 2: 112,008,931 L85P probably damaging Het
Olfr290 T G 7: 84,916,283 F168C probably damaging Het
Olfr305 G A 7: 86,363,744 L198F probably benign Het
Pbk T A 14: 65,815,284 L192* probably null Het
Pcdhga4 T C 18: 37,685,437 I13T probably benign Het
Peg10 A T 6: 4,754,294 probably benign Het
Polq T A 16: 37,027,814 V261D probably damaging Het
Ppp2r5b T A 19: 6,230,510 T313S possibly damaging Het
Ptk2 A T 15: 73,216,096 probably null Het
Ptpn7 T A 1: 135,137,880 probably null Het
Rab11fip1 A G 8: 27,153,083 S563P probably damaging Het
Scn1a A T 2: 66,328,522 C351* probably null Het
Slc10a5 A T 3: 10,334,799 V267D probably damaging Het
Slc37a2 T A 9: 37,235,108 M368L probably damaging Het
Slc6a20b T A 9: 123,596,048 T585S probably benign Het
Srcap T C 7: 127,557,610 probably null Het
Tbx18 T C 9: 87,727,449 M178V possibly damaging Het
Tmprss11b C A 5: 86,663,559 C172F probably damaging Het
Traf5 T C 1: 192,066,898 Q91R probably benign Het
Trappc8 A T 18: 20,825,065 Y1248N probably damaging Het
Trpa1 A G 1: 14,896,523 L539S possibly damaging Het
Ubr7 A T 12: 102,761,502 K94N probably damaging Het
Ugt2a1 C A 5: 87,486,035 probably null Het
Unc50 T A 1: 37,432,629 I120K probably damaging Het
Usp28 T C 9: 49,001,536 V29A probably damaging Het
Usp9y A G Y: 1,317,002 I1849T probably benign Het
Vmn2r102 T A 17: 19,677,941 V406E probably damaging Het
Vmn2r4 G A 3: 64,410,063 R85W probably benign Het
Xirp2 A G 2: 67,516,406 D2997G probably benign Het
Zc2hc1c A T 12: 85,290,208 E213V probably damaging Het
Zfp420 C T 7: 29,874,334 probably benign Het
Zfp641 C T 15: 98,293,704 E34K probably damaging Het
Other mutations in Tyrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Tyrp1 APN 4 80840765 missense possibly damaging 0.95
IGL01586:Tyrp1 APN 4 80844898 missense probably benign 0.00
IGL01620:Tyrp1 APN 4 80844802 nonsense probably null
IGL02126:Tyrp1 APN 4 80837608 nonsense probably null
IGL02174:Tyrp1 APN 4 80844826 nonsense probably null
IGL02601:Tyrp1 APN 4 80840775 missense probably null 0.00
IGL02630:Tyrp1 APN 4 80840757 missense possibly damaging 0.95
butter UTSW 4 80840806 critical splice donor site probably null
ca-los UTSW 4 80844868 nonsense probably null
chi UTSW 4 80840778 missense probably damaging 1.00
R0011:Tyrp1 UTSW 4 80840793 missense probably damaging 1.00
R0011:Tyrp1 UTSW 4 80840793 missense probably damaging 1.00
R0145:Tyrp1 UTSW 4 80840778 missense probably damaging 1.00
R1172:Tyrp1 UTSW 4 80844868 nonsense probably null
R1173:Tyrp1 UTSW 4 80844868 nonsense probably null
R1175:Tyrp1 UTSW 4 80844868 nonsense probably null
R1886:Tyrp1 UTSW 4 80840806 critical splice donor site probably null
R2099:Tyrp1 UTSW 4 80835379 missense possibly damaging 0.69
R2273:Tyrp1 UTSW 4 80837534 missense probably damaging 0.99
R2274:Tyrp1 UTSW 4 80837534 missense probably damaging 0.99
R2275:Tyrp1 UTSW 4 80837534 missense probably damaging 0.99
R2312:Tyrp1 UTSW 4 80837564 nonsense probably null
R2427:Tyrp1 UTSW 4 80850871 missense probably benign 0.00
R2440:Tyrp1 UTSW 4 80846606 missense probably benign 0.41
R2915:Tyrp1 UTSW 4 80837455 missense possibly damaging 0.46
R4343:Tyrp1 UTSW 4 80849841 missense possibly damaging 0.92
R4512:Tyrp1 UTSW 4 80837512 missense probably damaging 1.00
R4703:Tyrp1 UTSW 4 80840806 critical splice donor site probably null
R4732:Tyrp1 UTSW 4 80844935 missense possibly damaging 0.67
R4733:Tyrp1 UTSW 4 80844935 missense possibly damaging 0.67
R4788:Tyrp1 UTSW 4 80844943 nonsense probably null
R4911:Tyrp1 UTSW 4 80850907 utr 3 prime probably benign
R4938:Tyrp1 UTSW 4 80840646 missense probably damaging 1.00
R5129:Tyrp1 UTSW 4 80846607 missense probably damaging 1.00
R5154:Tyrp1 UTSW 4 80850717 missense probably benign 0.00
R6249:Tyrp1 UTSW 4 80850772 missense possibly damaging 0.93
R6492:Tyrp1 UTSW 4 80840781 missense probably null 1.00
R6617:Tyrp1 UTSW 4 80846747 missense probably benign 0.24
R6870:Tyrp1 UTSW 4 80850777 missense probably benign 0.37
R6990:Tyrp1 UTSW 4 80835437 missense probably damaging 1.00
R7275:Tyrp1 UTSW 4 80837584 missense possibly damaging 0.78
R7684:Tyrp1 UTSW 4 80840625 missense probably damaging 1.00
R7980:Tyrp1 UTSW 4 80840627 missense probably damaging 1.00
R8001:Tyrp1 UTSW 4 80840670 missense probably benign 0.10
R8051:Tyrp1 UTSW 4 80837660 missense probably damaging 1.00
R8233:Tyrp1 UTSW 4 80850953 missense unknown
R8326:Tyrp1 UTSW 4 80850684 missense probably benign 0.06
Z1176:Tyrp1 UTSW 4 80844889 nonsense probably null
Z1177:Tyrp1 UTSW 4 80849817 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAATGTCACCAGCCATTGC -3'
(R):5'- GAATTGATAACCACACCTTCAGGG -3'

Sequencing Primer
(F):5'- CATTGCTCTAGAGAGGCAACACTG -3'
(R):5'- GGTAAGCTCTTTGCAAAGCC -3'
Posted On2016-03-01