Incidental Mutation 'R4834:Itsn1'
ID373112
Institutional Source Beutler Lab
Gene Symbol Itsn1
Ensembl Gene ENSMUSG00000022957
Gene Nameintersectin 1 (SH3 domain protein 1A)
SynonymsIntersectin-L, EHSH1, Eh domain, SH3 domain regulator of endocytosis 1, Ese1, Sh3p17
MMRRC Submission 041977-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4834 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location91729281-91920597 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 91906789 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 87 (L87*)
Ref Sequence ENSEMBL: ENSMUSP00000156129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064797] [ENSMUST00000114002] [ENSMUST00000141625] [ENSMUST00000159295] [ENSMUST00000231735] [ENSMUST00000231852]
Predicted Effect probably null
Transcript: ENSMUST00000064797
AA Change: L1527*
SMART Domains Protein: ENSMUSP00000066361
Gene: ENSMUSG00000022957
AA Change: L1527*

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 803 1.62e-16 SMART
SH3 914 968 2.64e-16 SMART
SH3 1003 1057 1.82e-19 SMART
SH3 1075 1135 2.46e-16 SMART
SH3 1156 1211 7.97e-25 SMART
RhoGEF 1239 1420 1e-63 SMART
PH 1461 1571 6.07e-13 SMART
C2 1595 1692 1.58e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114002
AA Change: L1522*
SMART Domains Protein: ENSMUSP00000109635
Gene: ENSMUSG00000022957
AA Change: L1522*

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 798 1.05e-19 SMART
SH3 909 963 2.64e-16 SMART
SH3 998 1052 1.82e-19 SMART
SH3 1070 1130 2.46e-16 SMART
SH3 1151 1206 7.97e-25 SMART
RhoGEF 1234 1415 1e-63 SMART
PH 1456 1566 6.07e-13 SMART
C2 1590 1687 1.58e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125052
AA Change: L237*
SMART Domains Protein: ENSMUSP00000115985
Gene: ENSMUSG00000022957
AA Change: L237*

DomainStartEndE-ValueType
RhoGEF 6 185 1.19e-38 SMART
PH 172 282 6.07e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131739
SMART Domains Protein: ENSMUSP00000114145
Gene: ENSMUSG00000022957

DomainStartEndE-ValueType
SCOP:d1ki1b1 2 46 2e-11 SMART
Blast:PH 2 58 5e-32 BLAST
PDB:3QBV|D 2 59 8e-33 PDB
Predicted Effect probably null
Transcript: ENSMUST00000141625
AA Change: L65*
SMART Domains Protein: ENSMUSP00000115563
Gene: ENSMUSG00000022957
AA Change: L65*

DomainStartEndE-ValueType
PH 17 109 2.02e0 SMART
Pfam:C2 134 173 7.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159295
SMART Domains Protein: ENSMUSP00000125172
Gene: ENSMUSG00000116933

DomainStartEndE-ValueType
Pfam:OSCP 1 89 1.1e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000231735
AA Change: L87*
Predicted Effect probably null
Transcript: ENSMUST00000231852
AA Change: L87*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232198
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic membrane-associated protein that indirectly coordinates endocytic membrane traffic with the actin assembly machinery. In addition, the encoded protein may regulate the formation of clathrin-coated vesicles and could be involved in synaptic vesicle recycling. This protein has been shown to interact with dynamin, CDC42, SNAP23, SNAP25, SPIN90, EPS15, EPN1, EPN2, and STN2. Multiple transcript variants encoding different isoforms have been found for this gene, but the full-length nature of only two of them have been characterized so far. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous for a gene trapped allele exhibit embryonic lethal. Mice homozygous for a null allele exhibit some postnatal lethality and impaired vesicle recycling in surviving mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A C 9: 53,432,487 D146A possibly damaging Het
Acsl5 C A 19: 55,280,559 D217E probably benign Het
Acss3 A G 10: 107,084,805 probably null Het
Adam24 G A 8: 40,679,699 G69R probably damaging Het
Adgrg7 A T 16: 56,732,869 W622R probably damaging Het
Ankrd26 T C 6: 118,523,718 M931V probably benign Het
Ano8 C T 8: 71,484,295 V187M probably damaging Het
Ap3d1 A T 10: 80,719,726 C348S probably damaging Het
Apob T C 12: 8,014,101 V376A possibly damaging Het
Arhgap21 A T 2: 20,865,319 D925E probably damaging Het
Bmp6 T A 13: 38,485,841 V367E probably damaging Het
Bmp8b A T 4: 123,123,050 Q348L probably damaging Het
Ccr1l1 T C 9: 123,977,705 K235R probably damaging Het
Cd59a G A 2: 104,114,086 C93Y probably damaging Het
Clstn3 C T 6: 124,431,953 probably null Het
Col4a2 C A 8: 11,406,836 Y236* probably null Het
Csn1s2a T C 5: 87,781,778 F79L probably benign Het
Cyp4a10 A C 4: 115,525,808 Y360S probably damaging Het
Cyp4a29 A T 4: 115,249,670 I175F probably benign Het
D11Wsu47e C A 11: 113,688,979 T400K probably benign Het
Dck T A 5: 88,772,736 I105N probably damaging Het
Dicer1 A G 12: 104,696,591 L1577P probably benign Het
Dirc2 T A 16: 35,735,575 T172S probably benign Het
Disp2 G A 2: 118,792,504 S1239N probably benign Het
Dopey2 T C 16: 93,740,004 M1T probably null Het
E130308A19Rik T A 4: 59,690,317 C50* probably null Het
Elf2 A T 3: 51,277,221 D14E probably damaging Het
Epm2aip1 C T 9: 111,273,194 R412C probably benign Het
Foxm1 T C 6: 128,369,447 F114L probably damaging Het
Glcci1 C T 6: 8,582,601 R134* probably null Het
Gm996 T C 2: 25,579,518 E127G possibly damaging Het
Gspt1 T C 16: 11,222,717 K576E probably damaging Het
H2-M10.3 T C 17: 36,367,394 K180E probably benign Het
Hecw2 A T 1: 53,830,752 V1439E probably damaging Het
Hr T C 14: 70,559,922 S561P probably damaging Het
Hunk T C 16: 90,496,198 V456A probably benign Het
Il1rap T A 16: 26,676,935 D97E probably damaging Het
Inpp5d T G 1: 87,697,523 V474G possibly damaging Het
Izumo3 T C 4: 92,146,971 D3G possibly damaging Het
Kifc2 T A 15: 76,661,311 M1K probably null Het
Krt8 T A 15: 101,998,821 I276F probably damaging Het
Ksr2 C A 5: 117,668,327 Q402K probably benign Het
Lama2 A G 10: 27,006,749 V2606A probably benign Het
Met A G 6: 17,491,413 H58R probably damaging Het
Mier3 C T 13: 111,715,109 Q542* probably null Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Msl3l2 C T 10: 56,115,559 R127C probably damaging Het
Naglu T C 11: 101,076,988 L588P probably benign Het
Nf1 T C 11: 79,546,297 L2013P probably damaging Het
Nid1 A G 13: 13,508,823 Y1162C probably damaging Het
Nlrc5 G T 8: 94,505,485 R1313L probably benign Het
Nrg1 A G 8: 31,917,719 V162A probably benign Het
Nup188 T C 2: 30,339,584 L1310P probably damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1310 A G 2: 112,008,931 L85P probably damaging Het
Olfr290 T G 7: 84,916,283 F168C probably damaging Het
Olfr305 G A 7: 86,363,744 L198F probably benign Het
Pbk T A 14: 65,815,284 L192* probably null Het
Pcdhga4 T C 18: 37,685,437 I13T probably benign Het
Peg10 A T 6: 4,754,294 probably benign Het
Polq T A 16: 37,027,814 V261D probably damaging Het
Ppp2r5b T A 19: 6,230,510 T313S possibly damaging Het
Ptk2 A T 15: 73,216,096 probably null Het
Ptpn7 T A 1: 135,137,880 probably null Het
Rab11fip1 A G 8: 27,153,083 S563P probably damaging Het
Scn1a A T 2: 66,328,522 C351* probably null Het
Slc10a5 A T 3: 10,334,799 V267D probably damaging Het
Slc37a2 T A 9: 37,235,108 M368L probably damaging Het
Slc6a20b T A 9: 123,596,048 T585S probably benign Het
Srcap T C 7: 127,557,610 probably null Het
Tbx18 T C 9: 87,727,449 M178V possibly damaging Het
Tmprss11b C A 5: 86,663,559 C172F probably damaging Het
Traf5 T C 1: 192,066,898 Q91R probably benign Het
Trappc8 A T 18: 20,825,065 Y1248N probably damaging Het
Trpa1 A G 1: 14,896,523 L539S possibly damaging Het
Tyrp1 T A 4: 80,846,596 Y3* probably null Het
Ubr7 A T 12: 102,761,502 K94N probably damaging Het
Ugt2a1 C A 5: 87,486,035 probably null Het
Unc50 T A 1: 37,432,629 I120K probably damaging Het
Usp28 T C 9: 49,001,536 V29A probably damaging Het
Usp9y A G Y: 1,317,002 I1849T probably benign Het
Vmn2r102 T A 17: 19,677,941 V406E probably damaging Het
Vmn2r4 G A 3: 64,410,063 R85W probably benign Het
Xirp2 A G 2: 67,516,406 D2997G probably benign Het
Zc2hc1c A T 12: 85,290,208 E213V probably damaging Het
Zfp420 C T 7: 29,874,334 probably benign Het
Zfp641 C T 15: 98,293,704 E34K probably damaging Het
Other mutations in Itsn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Itsn1 APN 16 91806201 unclassified probably benign
IGL01799:Itsn1 APN 16 91848882 missense probably damaging 1.00
IGL02328:Itsn1 APN 16 91815407 missense probably damaging 1.00
IGL02333:Itsn1 APN 16 91820676 intron probably benign
IGL02503:Itsn1 APN 16 91889204 missense possibly damaging 0.62
IGL02628:Itsn1 APN 16 91899623 missense possibly damaging 0.79
IGL02666:Itsn1 APN 16 91820718 intron probably benign
IGL03007:Itsn1 APN 16 91784162 splice site probably benign
IGL03223:Itsn1 APN 16 91905306 missense probably benign 0.00
raphael UTSW 16 91820796 intron probably benign
weevil UTSW 16 91818552 intron probably benign
R0234:Itsn1 UTSW 16 91828280 nonsense probably null
R0234:Itsn1 UTSW 16 91828280 nonsense probably null
R0255:Itsn1 UTSW 16 91806090 unclassified probably benign
R0432:Itsn1 UTSW 16 91815520 missense probably damaging 1.00
R0455:Itsn1 UTSW 16 91868148 intron probably benign
R0471:Itsn1 UTSW 16 91899589 missense probably damaging 1.00
R0558:Itsn1 UTSW 16 91899623 missense possibly damaging 0.79
R0563:Itsn1 UTSW 16 91820796 intron probably benign
R1657:Itsn1 UTSW 16 91909223 missense probably damaging 1.00
R1671:Itsn1 UTSW 16 91812150 missense probably damaging 1.00
R1742:Itsn1 UTSW 16 91816959 critical splice donor site probably null
R1859:Itsn1 UTSW 16 91889154 intron probably benign
R1898:Itsn1 UTSW 16 91899580 missense probably damaging 1.00
R2016:Itsn1 UTSW 16 91905501 critical splice donor site probably null
R2221:Itsn1 UTSW 16 91853768 intron probably benign
R2244:Itsn1 UTSW 16 91853771 missense probably null
R3160:Itsn1 UTSW 16 91853044 nonsense probably null
R3162:Itsn1 UTSW 16 91853044 nonsense probably null
R3814:Itsn1 UTSW 16 91852921 missense possibly damaging 0.96
R4162:Itsn1 UTSW 16 91852902 missense probably benign 0.00
R4254:Itsn1 UTSW 16 91818552 intron probably benign
R4319:Itsn1 UTSW 16 91818552 intron probably benign
R4321:Itsn1 UTSW 16 91818552 intron probably benign
R4323:Itsn1 UTSW 16 91818552 intron probably benign
R4326:Itsn1 UTSW 16 91853855 intron probably benign
R4515:Itsn1 UTSW 16 91899649 missense probably damaging 0.99
R4584:Itsn1 UTSW 16 91820583 intron probably benign
R4600:Itsn1 UTSW 16 91899587 missense probably damaging 1.00
R4649:Itsn1 UTSW 16 91841588 missense probably damaging 1.00
R4868:Itsn1 UTSW 16 91785317 missense probably damaging 0.98
R5036:Itsn1 UTSW 16 91782235 splice site probably benign
R5122:Itsn1 UTSW 16 91893844 intron probably benign
R5161:Itsn1 UTSW 16 91908838 missense possibly damaging 0.95
R5437:Itsn1 UTSW 16 91818591 intron probably benign
R5538:Itsn1 UTSW 16 91784102 missense probably damaging 1.00
R5683:Itsn1 UTSW 16 91905380 missense probably benign 0.00
R5697:Itsn1 UTSW 16 91801589 missense possibly damaging 0.56
R5749:Itsn1 UTSW 16 91906855 missense probably damaging 0.99
R6083:Itsn1 UTSW 16 91853011 missense probably benign 0.01
R6148:Itsn1 UTSW 16 91816852 missense probably damaging 1.00
R6291:Itsn1 UTSW 16 91868096 intron probably benign
R6524:Itsn1 UTSW 16 91911995 missense probably damaging 0.96
R7175:Itsn1 UTSW 16 91868050 missense unknown
R7261:Itsn1 UTSW 16 91905306 missense probably benign 0.00
R7320:Itsn1 UTSW 16 91839699 missense unknown
R7366:Itsn1 UTSW 16 91908450 missense unknown
R7462:Itsn1 UTSW 16 91853185 missense possibly damaging 0.53
R7665:Itsn1 UTSW 16 91841603 missense unknown
R7720:Itsn1 UTSW 16 91868083 missense unknown
Predicted Primers PCR Primer
(F):5'- ACCTGCCGTCTAGATTACTGGG -3'
(R):5'- CTCATGCCAGATGTCTAACTTTTG -3'

Sequencing Primer
(F):5'- CTAGATTACTGGGTTGCACGCAC -3'
(R):5'- TACTTCCTTCCACACAGAGATG -3'
Posted On2016-03-01