Incidental Mutation 'R4834:Usp9y'
ID373121
Institutional Source Beutler Lab
Gene Symbol Usp9y
Ensembl Gene ENSMUSG00000069044
Gene Nameubiquitin specific peptidase 9, Y chromosome
SynonymsDffry, Fafl2
MMRRC Submission 041977-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4834 (G1)
Quality Score222
Status Not validated
ChromosomeY
Chromosomal Location1298961-1459782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 1317002 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1849 (I1849T)
Ref Sequence ENSEMBL: ENSMUSP00000088727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091188]
Predicted Effect probably benign
Transcript: ENSMUST00000091188
AA Change: I1849T

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000088727
Gene: ENSMUSG00000069044
AA Change: I1849T

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
low complexity region 286 301 N/A INTRINSIC
low complexity region 973 983 N/A INTRINSIC
low complexity region 1089 1100 N/A INTRINSIC
low complexity region 1352 1363 N/A INTRINSIC
Pfam:UCH 1558 1955 9.2e-53 PFAM
Pfam:UCH_1 1559 1909 4e-22 PFAM
low complexity region 1959 1971 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the peptidase C19 family. It encodes a protein that is similar to ubiquitin-specific proteases, which cleave the ubiquitin moiety from ubiquitin-fused precursors and ubiquitinylated proteins. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A C 9: 53,432,487 D146A possibly damaging Het
Acsl5 C A 19: 55,280,559 D217E probably benign Het
Acss3 A G 10: 107,084,805 probably null Het
Adam24 G A 8: 40,679,699 G69R probably damaging Het
Adgrg7 A T 16: 56,732,869 W622R probably damaging Het
Ankrd26 T C 6: 118,523,718 M931V probably benign Het
Ano8 C T 8: 71,484,295 V187M probably damaging Het
Ap3d1 A T 10: 80,719,726 C348S probably damaging Het
Apob T C 12: 8,014,101 V376A possibly damaging Het
Arhgap21 A T 2: 20,865,319 D925E probably damaging Het
Bmp6 T A 13: 38,485,841 V367E probably damaging Het
Bmp8b A T 4: 123,123,050 Q348L probably damaging Het
Ccr1l1 T C 9: 123,977,705 K235R probably damaging Het
Cd59a G A 2: 104,114,086 C93Y probably damaging Het
Clstn3 C T 6: 124,431,953 probably null Het
Col4a2 C A 8: 11,406,836 Y236* probably null Het
Csn1s2a T C 5: 87,781,778 F79L probably benign Het
Cyp4a10 A C 4: 115,525,808 Y360S probably damaging Het
Cyp4a29 A T 4: 115,249,670 I175F probably benign Het
D11Wsu47e C A 11: 113,688,979 T400K probably benign Het
Dck T A 5: 88,772,736 I105N probably damaging Het
Dicer1 A G 12: 104,696,591 L1577P probably benign Het
Dirc2 T A 16: 35,735,575 T172S probably benign Het
Disp2 G A 2: 118,792,504 S1239N probably benign Het
Dopey2 T C 16: 93,740,004 M1T probably null Het
E130308A19Rik T A 4: 59,690,317 C50* probably null Het
Elf2 A T 3: 51,277,221 D14E probably damaging Het
Epm2aip1 C T 9: 111,273,194 R412C probably benign Het
Foxm1 T C 6: 128,369,447 F114L probably damaging Het
Glcci1 C T 6: 8,582,601 R134* probably null Het
Gm996 T C 2: 25,579,518 E127G possibly damaging Het
Gspt1 T C 16: 11,222,717 K576E probably damaging Het
H2-M10.3 T C 17: 36,367,394 K180E probably benign Het
Hecw2 A T 1: 53,830,752 V1439E probably damaging Het
Hr T C 14: 70,559,922 S561P probably damaging Het
Hunk T C 16: 90,496,198 V456A probably benign Het
Il1rap T A 16: 26,676,935 D97E probably damaging Het
Inpp5d T G 1: 87,697,523 V474G possibly damaging Het
Itsn1 T A 16: 91,906,789 L87* probably null Het
Izumo3 T C 4: 92,146,971 D3G possibly damaging Het
Kifc2 T A 15: 76,661,311 M1K probably null Het
Krt8 T A 15: 101,998,821 I276F probably damaging Het
Ksr2 C A 5: 117,668,327 Q402K probably benign Het
Lama2 A G 10: 27,006,749 V2606A probably benign Het
Met A G 6: 17,491,413 H58R probably damaging Het
Mier3 C T 13: 111,715,109 Q542* probably null Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Msl3l2 C T 10: 56,115,559 R127C probably damaging Het
Naglu T C 11: 101,076,988 L588P probably benign Het
Nf1 T C 11: 79,546,297 L2013P probably damaging Het
Nid1 A G 13: 13,508,823 Y1162C probably damaging Het
Nlrc5 G T 8: 94,505,485 R1313L probably benign Het
Nrg1 A G 8: 31,917,719 V162A probably benign Het
Nup188 T C 2: 30,339,584 L1310P probably damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1310 A G 2: 112,008,931 L85P probably damaging Het
Olfr290 T G 7: 84,916,283 F168C probably damaging Het
Olfr305 G A 7: 86,363,744 L198F probably benign Het
Pbk T A 14: 65,815,284 L192* probably null Het
Pcdhga4 T C 18: 37,685,437 I13T probably benign Het
Peg10 A T 6: 4,754,294 probably benign Het
Polq T A 16: 37,027,814 V261D probably damaging Het
Ppp2r5b T A 19: 6,230,510 T313S possibly damaging Het
Ptk2 A T 15: 73,216,096 probably null Het
Ptpn7 T A 1: 135,137,880 probably null Het
Rab11fip1 A G 8: 27,153,083 S563P probably damaging Het
Scn1a A T 2: 66,328,522 C351* probably null Het
Slc10a5 A T 3: 10,334,799 V267D probably damaging Het
Slc37a2 T A 9: 37,235,108 M368L probably damaging Het
Slc6a20b T A 9: 123,596,048 T585S probably benign Het
Srcap T C 7: 127,557,610 probably null Het
Tbx18 T C 9: 87,727,449 M178V possibly damaging Het
Tmprss11b C A 5: 86,663,559 C172F probably damaging Het
Traf5 T C 1: 192,066,898 Q91R probably benign Het
Trappc8 A T 18: 20,825,065 Y1248N probably damaging Het
Trpa1 A G 1: 14,896,523 L539S possibly damaging Het
Tyrp1 T A 4: 80,846,596 Y3* probably null Het
Ubr7 A T 12: 102,761,502 K94N probably damaging Het
Ugt2a1 C A 5: 87,486,035 probably null Het
Unc50 T A 1: 37,432,629 I120K probably damaging Het
Usp28 T C 9: 49,001,536 V29A probably damaging Het
Vmn2r102 T A 17: 19,677,941 V406E probably damaging Het
Vmn2r4 G A 3: 64,410,063 R85W probably benign Het
Xirp2 A G 2: 67,516,406 D2997G probably benign Het
Zc2hc1c A T 12: 85,290,208 E213V probably damaging Het
Zfp420 C T 7: 29,874,334 probably benign Het
Zfp641 C T 15: 98,293,704 E34K probably damaging Het
Other mutations in Usp9y
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4466001:Usp9y UTSW Y 1432197 missense probably damaging 0.96
R0288:Usp9y UTSW Y 1333606 splice site probably benign
R0365:Usp9y UTSW Y 1364732 missense probably damaging 1.00
R0386:Usp9y UTSW Y 1316933 missense probably damaging 1.00
R0395:Usp9y UTSW Y 1340053 missense probably damaging 1.00
R0518:Usp9y UTSW Y 1307880 missense probably benign
R0521:Usp9y UTSW Y 1307880 missense probably benign
R0530:Usp9y UTSW Y 1333600 splice site probably benign
R0759:Usp9y UTSW Y 1299097 missense probably damaging 0.99
R0849:Usp9y UTSW Y 1394002 missense probably damaging 1.00
R0932:Usp9y UTSW Y 1315930 missense probably benign 0.37
R1018:Usp9y UTSW Y 1341414 splice site probably benign
R1208:Usp9y UTSW Y 1356282 missense probably benign
R1208:Usp9y UTSW Y 1356282 missense probably benign
R1470:Usp9y UTSW Y 1332471 missense probably benign 0.19
R1470:Usp9y UTSW Y 1332471 missense probably benign 0.19
R1730:Usp9y UTSW Y 1367093 missense probably benign 0.18
R1743:Usp9y UTSW Y 1316727 missense probably damaging 1.00
R1765:Usp9y UTSW Y 1384454 missense possibly damaging 0.88
R1775:Usp9y UTSW Y 1368089 missense probably damaging 1.00
R1783:Usp9y UTSW Y 1367093 missense probably benign 0.18
R1889:Usp9y UTSW Y 1448829 intron probably null
R1901:Usp9y UTSW Y 1303371 critical splice donor site probably null
R2081:Usp9y UTSW Y 1381277 missense possibly damaging 0.65
R2119:Usp9y UTSW Y 1303451 missense probably benign 0.00
R2357:Usp9y UTSW Y 1394050 missense possibly damaging 0.87
R2873:Usp9y UTSW Y 1310502 splice site probably benign
R3938:Usp9y UTSW Y 1313741 missense probably damaging 0.97
R4323:Usp9y UTSW Y 1434407 missense possibly damaging 0.93
R4385:Usp9y UTSW Y 1304756 missense probably damaging 1.00
R4407:Usp9y UTSW Y 1336375 missense probably benign 0.16
R4457:Usp9y UTSW Y 1394078 missense possibly damaging 0.62
R4747:Usp9y UTSW Y 1391284 missense possibly damaging 0.64
R4823:Usp9y UTSW Y 1444559 missense probably damaging 0.99
R4872:Usp9y UTSW Y 1307920 missense probably damaging 1.00
R4911:Usp9y UTSW Y 1308041 missense probably damaging 0.96
R4915:Usp9y UTSW Y 1316735 missense probably damaging 0.99
R4962:Usp9y UTSW Y 1384336 missense probably damaging 1.00
R5378:Usp9y UTSW Y 1315928 missense probably damaging 0.99
R5422:Usp9y UTSW Y 1314676 missense probably benign
R5432:Usp9y UTSW Y 1368022 splice site probably null
R5442:Usp9y UTSW Y 1336467 missense possibly damaging 0.80
R5469:Usp9y UTSW Y 1364714 missense probably benign 0.01
R5500:Usp9y UTSW Y 1341875 missense probably damaging 1.00
R5729:Usp9y UTSW Y 1381339 missense probably damaging 0.97
R5891:Usp9y UTSW Y 1341535 missense probably benign 0.05
R5920:Usp9y UTSW Y 1316730 missense probably damaging 1.00
R5948:Usp9y UTSW Y 1324996 missense possibly damaging 0.79
R6062:Usp9y UTSW Y 1454199 missense probably benign 0.28
R6265:Usp9y UTSW Y 1446843 missense probably benign 0.00
R6274:Usp9y UTSW Y 1316735 missense probably damaging 0.99
R6313:Usp9y UTSW Y 1385355 missense probably benign
R6330:Usp9y UTSW Y 1340123 missense probably benign 0.20
R6471:Usp9y UTSW Y 1384511 missense probably damaging 1.00
R6547:Usp9y UTSW Y 1444612 missense probably damaging 0.99
R6791:Usp9y UTSW Y 1325042 splice site probably null
R7194:Usp9y UTSW Y 1304672 missense probably damaging 1.00
R7357:Usp9y UTSW Y 1333656 missense possibly damaging 0.58
R7374:Usp9y UTSW Y 1381305 missense probably benign 0.00
R7404:Usp9y UTSW Y 1341780 missense probably benign 0.35
R7481:Usp9y UTSW Y 1432180 missense probably benign 0.08
R7584:Usp9y UTSW Y 1384451 missense probably damaging 1.00
R7697:Usp9y UTSW Y 1316990 missense possibly damaging 0.72
R7713:Usp9y UTSW Y 1304411 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGCCTGTATGACATACGCTTC -3'
(R):5'- AGTTACTGGAAAGTGTCTCAGG -3'

Sequencing Primer
(F):5'- CTGTATGACATACGCTTCATCATATG -3'
(R):5'- GTCTCAGGTAATAAAAATGACCTCC -3'
Posted On2016-03-01