Mutagenetix > Incidental Mutations

Incidental Mutation 'R4835:Ncoa6'

373130

Institutional Source

Beutler Lab

Gene Symbol

Ncoa6

Ensembl Gene

ENSMUSG00000038369

Gene Name

nuclear receptor coactivator 6

Synonyms

PRIP, ASC-2, NRC, AIB3, RAP250, ASC2

MMRRC Submission

042450-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4835 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

155390656-155473894 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 155407133 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1417 (V1417A)

Ref Sequence

ENSEMBL: ENSMUSP00000118113 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043126] [ENSMUST00000109670] [ENSMUST00000123293]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043126
AA Change: V1417A

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000045386
Gene: ENSMUSG00000038369
AA Change: V1417A

Domain	Start	End	E-Value	Type
Pfam:Nucleic_acid_bd	47	190	3.3e-55	PFAM
coiled coil region	256	296	N/A	INTRINSIC
low complexity region	375	383	N/A	INTRINSIC
internal_repeat_1	450	597	3.31e-5	PROSPERO
low complexity region	615	630	N/A	INTRINSIC
internal_repeat_1	636	793	3.31e-5	PROSPERO
low complexity region	844	860	N/A	INTRINSIC
low complexity region	909	931	N/A	INTRINSIC
low complexity region	986	998	N/A	INTRINSIC
low complexity region	1002	1046	N/A	INTRINSIC
low complexity region	1126	1139	N/A	INTRINSIC
low complexity region	1258	1273	N/A	INTRINSIC
low complexity region	1328	1351	N/A	INTRINSIC
low complexity region	1543	1564	N/A	INTRINSIC
low complexity region	1578	1599	N/A	INTRINSIC
low complexity region	1607	1618	N/A	INTRINSIC
low complexity region	1808	1825	N/A	INTRINSIC
low complexity region	1894	1908	N/A	INTRINSIC
low complexity region	2043	2053	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109670
AA Change: V1417A

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000105295
Gene: ENSMUSG00000038369
AA Change: V1417A

Domain	Start	End	E-Value	Type
Pfam:Nucleic_acid_bd	45	195	3.6e-60	PFAM
coiled coil region	256	296	N/A	INTRINSIC
low complexity region	375	383	N/A	INTRINSIC
internal_repeat_1	450	597	3.31e-5	PROSPERO
low complexity region	615	630	N/A	INTRINSIC
internal_repeat_1	636	793	3.31e-5	PROSPERO
low complexity region	844	860	N/A	INTRINSIC
low complexity region	909	931	N/A	INTRINSIC
low complexity region	986	998	N/A	INTRINSIC
low complexity region	1002	1046	N/A	INTRINSIC
low complexity region	1126	1139	N/A	INTRINSIC
low complexity region	1258	1273	N/A	INTRINSIC
low complexity region	1328	1351	N/A	INTRINSIC
low complexity region	1543	1564	N/A	INTRINSIC
low complexity region	1578	1599	N/A	INTRINSIC
low complexity region	1607	1618	N/A	INTRINSIC
low complexity region	1808	1825	N/A	INTRINSIC
low complexity region	1894	1908	N/A	INTRINSIC
low complexity region	2043	2053	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000123293
AA Change: V1417A

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000118113
Gene: ENSMUSG00000038369
AA Change: V1417A

Domain	Start	End	E-Value	Type
Pfam:Nucleic_acid_bd	45	195	2.4e-60	PFAM
coiled coil region	256	296	N/A	INTRINSIC
low complexity region	375	383	N/A	INTRINSIC
low complexity region	564	573	N/A	INTRINSIC
low complexity region	615	630	N/A	INTRINSIC
low complexity region	844	860	N/A	INTRINSIC
low complexity region	909	931	N/A	INTRINSIC
low complexity region	986	998	N/A	INTRINSIC
low complexity region	1002	1046	N/A	INTRINSIC
low complexity region	1126	1139	N/A	INTRINSIC
low complexity region	1258	1273	N/A	INTRINSIC
low complexity region	1328	1351	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146942

Meta Mutation Damage Score

0.0596

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

98% (96/98)

MGI Phenotype

PHENOTYPE: Homozygotes for targeted null mutations exhibit retarded embryonic growth and defects of the placenta, heart, liver, and nervous system. Mutants die around midgestation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	T	7: 29,574,901		noncoding transcript	Het
4933434E20Rik	A	G	3: 90,063,209	N17D	probably benign	Het
A1bg	T	C	15: 60,920,251	D176G	probably benign	Het
Abcg5	A	T	17: 84,658,648	M428K	possibly damaging	Het
Adam1a	A	T	5: 121,519,689	C514S	probably damaging	Het
Angptl3	A	G	4: 99,037,412	Q325R	probably benign	Het
Ankrd26	C	T	6: 118,548,850	W378*	probably null	Het
Apob	T	C	12: 8,015,391	V4087A	possibly damaging	Het
Auts2	A	G	5: 131,466,093	I117T	probably damaging	Het
AW146154	T	A	7: 41,480,468	E408V	probably damaging	Het
Bicd1	A	T	6: 149,484,090	N107I	probably benign	Het
Blm	T	C	7: 80,509,546	S281G	probably benign	Het
Btaf1	T	A	19: 37,002,458	D1542E	probably benign	Het
C2cd2l	A	G	9: 44,315,145		probably null	Het
Capn8	C	A	1: 182,604,551	N362K	probably damaging	Het
Ccdc14	T	G	16: 34,705,038	S186A	probably damaging	Het
Cdca4	A	G	12: 112,821,547	L187P	probably damaging	Het
Chil6	T	A	3: 106,405,974	K20*	probably null	Het
Cmss1	A	T	16: 57,316,182	L109*	probably null	Het
Cmtm6	G	T	9: 114,731,342	W36L	probably benign	Het
Cnksr3	T	G	10: 7,160,757	I35L	possibly damaging	Het
Col4a2	G	T	8: 11,423,570	G534*	probably null	Het
Col5a1	T	G	2: 28,025,644	V180G	probably damaging	Het
Ctnna3	T	C	10: 63,581,944	F154L	probably benign	Het
Fabp7	G	A	10: 57,785,580	V50M	possibly damaging	Het
Fam170a	T	A	18: 50,281,983	V232D	probably damaging	Het
Fam186a	T	G	15: 99,945,808	T852P	unknown	Het
Fam20a	T	C	11: 109,673,563	I455V	probably benign	Het
Fbxl6	C	T	15: 76,536,804	V324M	probably damaging	Het
Galnt18	T	C	7: 111,779,523	T9A	probably damaging	Het
Golgb1	T	A	16: 36,891,407	M191K	possibly damaging	Het
Gpld1	A	G	13: 24,982,716	T650A	probably benign	Het
Gprc5d	A	G	6: 135,116,517	F131L	probably benign	Het
H2afv	C	T	11: 6,439,437	G7E	unknown	Het
Haus4	A	T	14: 54,545,835		probably null	Het
Helq	A	G	5: 100,774,163	I725T	possibly damaging	Het
Igsf23	T	A	7: 19,941,830	D117V	possibly damaging	Het
Kiz	A	T	2: 146,942,088	S514C	probably damaging	Het
Klhl6	A	T	16: 19,957,033	N258K	probably benign	Het
Krt72	G	C	15: 101,781,073		probably null	Het
Large1	A	T	8: 73,048,347	I245N	probably damaging	Het
Lrrc31	T	C	3: 30,679,157	I469M	probably damaging	Het
Lypd4	T	A	7: 24,866,696	I68F	probably benign	Het
Mast1	A	G	8: 84,923,779	S442P	probably damaging	Het
Mmp20	T	A	9: 7,645,299	H283Q	probably benign	Het
Mrps5	G	A	2: 127,603,707	V385M	possibly damaging	Het
Ms4a15	T	C	19: 10,979,226	K241E	possibly damaging	Het
Myt1	A	G	2: 181,797,462	E259G	probably damaging	Het
Myt1l	C	A	12: 29,895,305	T1023K	unknown	Het
Ncapd3	T	C	9: 27,086,046	L1221P	probably damaging	Het
Nmnat1	A	G	4: 149,473,345	V80A	possibly damaging	Het
Nwd2	A	G	5: 63,807,846	E1591G	probably benign	Het
Olfr1057	A	G	2: 86,374,509	L301S	possibly damaging	Het
Olfr455	A	G	6: 42,538,836	F62S	probably damaging	Het
Osbpl1a	A	T	18: 12,768,536		probably null	Het
Papln	T	C	12: 83,774,420	I204T	probably damaging	Het
Phf1	A	G	17: 26,934,678	T97A	probably benign	Het
Plxnb1	A	G	9: 109,105,374	D890G	probably damaging	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Ptgir	A	G	7: 16,906,869	M29V	possibly damaging	Het
Rbp2	G	A	9: 98,507,823	C96Y	probably damaging	Het
Rgmb	A	T	17: 15,807,362	M365K	possibly damaging	Het
Ric1	A	G	19: 29,595,536	N792S	possibly damaging	Het
Ruvbl1	T	C	6: 88,497,229	Y405H	possibly damaging	Het
Scaf4	A	G	16: 90,250,307	M394T	unknown	Het
Siglech	T	A	7: 55,768,429	C48*	probably null	Het
Skiv2l	A	G	17: 34,842,921	V695A	possibly damaging	Het
Slc2a5	A	G	4: 150,140,005	T320A	probably benign	Het
Slc6a7	T	C	18: 61,002,205	Y417C	probably benign	Het
Sox21	A	G	14: 118,234,924	C238R	possibly damaging	Het
Tbata	A	T	10: 61,183,353	K109N	probably damaging	Het
Tecpr2	T	G	12: 110,954,730	S1246A	probably benign	Het
Tekt3	A	G	11: 63,081,259	D247G	probably benign	Het
Tenm3	A	T	8: 48,313,236		probably null	Het
Thada	A	T	17: 84,441,104		probably null	Het
Tpcn2	C	T	7: 145,272,351	G204R	probably damaging	Het
Tpm2	T	C	4: 43,519,220		probably null	Het
Trbv24	T	C	6: 41,218,092		probably benign	Het
Tyw1	A	G	5: 130,277,058	R341G	probably benign	Het
Vmn1r183	T	G	7: 24,055,139	N122K	probably benign	Het
Vmn2r61	T	A	7: 42,267,035	H357Q	possibly damaging	Het
Vps13b	C	T	15: 35,869,372	T2674I	probably damaging	Het
Vps13b	T	C	15: 35,910,293	L3401P	probably benign	Het
Vps16	T	G	2: 130,438,300		probably benign	Het
Vrtn	T	A	12: 84,649,694	I406N	probably damaging	Het
Vwa8	A	T	14: 78,934,613	Y278F	probably benign	Het
Washc4	A	T	10: 83,579,512	I789F	possibly damaging	Het
Zbtb20	C	A	16: 43,618,398	T627K	probably damaging	Het
Zfyve16	A	T	13: 92,522,185	I406K	probably benign	Het
Zfyve9	A	C	4: 108,717,998	S629A	possibly damaging	Het
Zpld1	A	T	16: 55,248,255	N164K	probably damaging	Het

Other mutations in Ncoa6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Ncoa6	APN	2	155406208	missense	probably damaging	0.99
IGL00849:Ncoa6	APN	2	155421688	missense	possibly damaging	0.89
IGL00933:Ncoa6	APN	2	155415397	missense	probably damaging	1.00
IGL00981:Ncoa6	APN	2	155406179	missense	probably damaging	0.98
IGL01420:Ncoa6	APN	2	155407587	missense	probably damaging	1.00
IGL02160:Ncoa6	APN	2	155421083	missense	possibly damaging	0.65
IGL03049:Ncoa6	APN	2	155419014	missense	probably damaging	1.00
IGL03194:Ncoa6	APN	2	155415868	missense	possibly damaging	0.94
IGL03269:Ncoa6	APN	2	155406489	missense	probably damaging	0.97
IGL03299:Ncoa6	APN	2	155407287	missense	probably damaging	0.97
IGL03306:Ncoa6	APN	2	155405507	missense	probably benign	0.30
alcoa	UTSW	2	155402664	unclassified	probably benign
Aluminum	UTSW	2	155399693	critical splice acceptor site	probably null
balboa	UTSW	2	155406949	missense	probably benign	0.05
mauna_loa	UTSW	2	155415227	missense	probably damaging	0.99
PIT4466001:Ncoa6	UTSW	2	155405657	missense	probably benign
R0011:Ncoa6	UTSW	2	155408291	frame shift	probably null
R0014:Ncoa6	UTSW	2	155438043	missense	possibly damaging	0.86
R0079:Ncoa6	UTSW	2	155408291	frame shift	probably null
R0080:Ncoa6	UTSW	2	155408291	frame shift	probably null
R0081:Ncoa6	UTSW	2	155408291	frame shift	probably null
R0164:Ncoa6	UTSW	2	155408291	frame shift	probably null
R0166:Ncoa6	UTSW	2	155408291	frame shift	probably null
R0172:Ncoa6	UTSW	2	155408291	frame shift	probably null
R0173:Ncoa6	UTSW	2	155408291	frame shift	probably null
R0245:Ncoa6	UTSW	2	155391211	missense	probably benign	0.00
R0284:Ncoa6	UTSW	2	155408291	frame shift	probably null
R0285:Ncoa6	UTSW	2	155408291	frame shift	probably null
R0285:Ncoa6	UTSW	2	155415701	missense	probably damaging	0.96
R0288:Ncoa6	UTSW	2	155408291	frame shift	probably null
R0539:Ncoa6	UTSW	2	155415697	missense	probably benign	0.08
R0652:Ncoa6	UTSW	2	155391211	missense	probably benign	0.00
R0781:Ncoa6	UTSW	2	155411520	splice site	probably benign
R1053:Ncoa6	UTSW	2	155434040	missense	probably damaging	1.00
R1110:Ncoa6	UTSW	2	155411520	splice site	probably benign
R1420:Ncoa6	UTSW	2	155421153	nonsense	probably null
R1521:Ncoa6	UTSW	2	155415222	missense	possibly damaging	0.78
R1541:Ncoa6	UTSW	2	155415304	missense	probably benign	0.35
R1677:Ncoa6	UTSW	2	155402664	unclassified	probably benign
R1858:Ncoa6	UTSW	2	155421639	missense	probably benign	0.13
R1954:Ncoa6	UTSW	2	155406821	missense	possibly damaging	0.94
R1955:Ncoa6	UTSW	2	155406821	missense	possibly damaging	0.94
R2040:Ncoa6	UTSW	2	155406080	missense	probably damaging	0.98
R2087:Ncoa6	UTSW	2	155406159	nonsense	probably null
R2159:Ncoa6	UTSW	2	155407713	missense	probably damaging	1.00
R2278:Ncoa6	UTSW	2	155407650	missense	possibly damaging	0.94
R2696:Ncoa6	UTSW	2	155438015	missense	probably benign	0.45
R2891:Ncoa6	UTSW	2	155437961	missense	possibly damaging	0.86
R3618:Ncoa6	UTSW	2	155407789	missense	possibly damaging	0.95
R3747:Ncoa6	UTSW	2	155411641	missense	probably benign	0.01
R3778:Ncoa6	UTSW	2	155421195	missense	probably damaging	1.00
R3784:Ncoa6	UTSW	2	155407757	missense	probably damaging	1.00
R3802:Ncoa6	UTSW	2	155405564	missense	probably benign
R3820:Ncoa6	UTSW	2	155406938	missense	probably damaging	1.00
R3821:Ncoa6	UTSW	2	155406938	missense	probably damaging	1.00
R3822:Ncoa6	UTSW	2	155406938	missense	probably damaging	1.00
R3870:Ncoa6	UTSW	2	155415557	splice site	probably null
R4037:Ncoa6	UTSW	2	155407370	missense	probably damaging	0.98
R4488:Ncoa6	UTSW	2	155407476	missense	possibly damaging	0.94
R4719:Ncoa6	UTSW	2	155391161	unclassified	probably benign
R4732:Ncoa6	UTSW	2	155421301	missense	probably damaging	1.00
R4733:Ncoa6	UTSW	2	155421301	missense	probably damaging	1.00
R4829:Ncoa6	UTSW	2	155415227	missense	probably damaging	0.99
R4883:Ncoa6	UTSW	2	155406767	missense	probably benign	0.29
R4967:Ncoa6	UTSW	2	155421332	missense	possibly damaging	0.80
R5021:Ncoa6	UTSW	2	155406949	missense	probably benign	0.05
R5234:Ncoa6	UTSW	2	155438013	missense	probably benign	0.01
R5356:Ncoa6	UTSW	2	155421192	missense	probably damaging	0.99
R5358:Ncoa6	UTSW	2	155406987	missense	probably damaging	0.97
R5375:Ncoa6	UTSW	2	155433995	missense	probably benign	0.16
R5412:Ncoa6	UTSW	2	155407781	missense	possibly damaging	0.95
R5579:Ncoa6	UTSW	2	155406677	missense	probably damaging	1.00
R5618:Ncoa6	UTSW	2	155437897	missense	possibly damaging	0.86
R5641:Ncoa6	UTSW	2	155421836	missense	probably benign	0.22
R5757:Ncoa6	UTSW	2	155411608	missense	probably damaging	1.00
R5761:Ncoa6	UTSW	2	155408141	missense	probably benign	0.11
R5778:Ncoa6	UTSW	2	155406768	missense	probably benign	0.01
R5852:Ncoa6	UTSW	2	155405499	missense	possibly damaging	0.88
R5940:Ncoa6	UTSW	2	155415865	missense	probably damaging	0.98
R6155:Ncoa6	UTSW	2	155407448	missense	probably damaging	1.00
R6374:Ncoa6	UTSW	2	155421156	missense	probably damaging	1.00
R6389:Ncoa6	UTSW	2	155395816	missense	probably damaging	0.98
R6669:Ncoa6	UTSW	2	155399693	critical splice acceptor site	probably null
R7097:Ncoa6	UTSW	2	155438063	missense	probably benign	0.01
R7385:Ncoa6	UTSW	2	155407801	missense	probably damaging	1.00
R7963:Ncoa6	UTSW	2	155405996	missense	probably benign	0.30
R8356:Ncoa6	UTSW	2	155406252	missense	possibly damaging	0.59
R8698:Ncoa6	UTSW	2	155415121	missense	possibly damaging	0.94
R8859:Ncoa6	UTSW	2	155406468	missense	possibly damaging	0.63
R8870:Ncoa6	UTSW	2	155421158	missense	probably damaging	0.99
R9041:Ncoa6	UTSW	2	155415530	missense	possibly damaging	0.89
R9062:Ncoa6	UTSW	2	155421428	missense	probably benign	0.42
R9088:Ncoa6	UTSW	2	155407806	missense	probably damaging	0.98
R9225:Ncoa6	UTSW	2	155407521	missense	possibly damaging	0.95
RF033:Ncoa6	UTSW	2	155421731	small deletion	probably benign
RF040:Ncoa6	UTSW	2	155421731	small deletion	probably benign
RF048:Ncoa6	UTSW	2	155421712	small deletion	probably benign
X0017:Ncoa6	UTSW	2	155406540	missense	probably benign	0.05
Z1176:Ncoa6	UTSW	2	155421302	missense	probably damaging	0.99
Z1177:Ncoa6	UTSW	2	155406142	missense	possibly damaging	0.67
Z1177:Ncoa6	UTSW	2	155421218	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCTTCAACACTGGGGAGTTTG -3'
(R):5'- AAGTCCTGGAAGGCAAAACTC -3'

Sequencing Primer
(F):5'- GTTAGGATCCAATGGTTGCCC -3'
(R):5'- AAGCTCCTAAACTTACTCTGGC -3'

Posted On

2016-03-01