Incidental Mutation 'R4835:Adam1a'
ID373140
Institutional Source Beutler Lab
Gene Symbol Adam1a
Ensembl Gene ENSMUSG00000072647
Gene Namea disintegrin and metallopeptidase domain 1a
Synonymsfertilin alpha, Ftna, PH-30 alpha
MMRRC Submission 042450-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R4835 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location121518576-121545482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121519689 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 514 (C514S)
Ref Sequence ENSEMBL: ENSMUSP00000098320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100757] [ENSMUST00000111795] [ENSMUST00000125946] [ENSMUST00000156080] [ENSMUST00000200170]
Predicted Effect probably damaging
Transcript: ENSMUST00000100757
AA Change: C514S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098320
Gene: ENSMUSG00000072647
AA Change: C514S

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 70 191 1.5e-18 PFAM
Pfam:Reprolysin_5 233 410 2.8e-15 PFAM
Pfam:Reprolysin_4 234 421 6.3e-9 PFAM
Pfam:Reprolysin 235 429 1.3e-70 PFAM
Pfam:Reprolysin_3 255 381 3.8e-14 PFAM
Pfam:Reprolysin_2 255 419 5.6e-9 PFAM
DISIN 447 520 6.45e-37 SMART
ACR 521 660 4.59e-62 SMART
EGF 666 697 1.99e1 SMART
transmembrane domain 741 763 N/A INTRINSIC
low complexity region 764 791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111795
SMART Domains Protein: ENSMUSP00000144614
Gene: ENSMUSG00000029452

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125946
SMART Domains Protein: ENSMUSP00000142503
Gene: ENSMUSG00000105340

DomainStartEndE-ValueType
S_TKc 22 304 5.3e-84 SMART
coiled coil region 407 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156080
SMART Domains Protein: ENSMUSP00000121579
Gene: ENSMUSG00000029452

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200170
SMART Domains Protein: ENSMUSP00000143668
Gene: ENSMUSG00000072647

DomainStartEndE-ValueType
S_TKc 22 304 8.22e-84 SMART
coiled coil region 407 432 N/A INTRINSIC
Meta Mutation Damage Score 0.0312 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (96/98)
MGI Phenotype PHENOTYPE: Homozygous null mice display male infertility with asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,574,901 noncoding transcript Het
4933434E20Rik A G 3: 90,063,209 N17D probably benign Het
A1bg T C 15: 60,920,251 D176G probably benign Het
Abcg5 A T 17: 84,658,648 M428K possibly damaging Het
Angptl3 A G 4: 99,037,412 Q325R probably benign Het
Ankrd26 C T 6: 118,548,850 W378* probably null Het
Apob T C 12: 8,015,391 V4087A possibly damaging Het
Auts2 A G 5: 131,466,093 I117T probably damaging Het
AW146154 T A 7: 41,480,468 E408V probably damaging Het
Bicd1 A T 6: 149,484,090 N107I probably benign Het
Blm T C 7: 80,509,546 S281G probably benign Het
Btaf1 T A 19: 37,002,458 D1542E probably benign Het
C2cd2l A G 9: 44,315,145 probably null Het
Capn8 C A 1: 182,604,551 N362K probably damaging Het
Ccdc14 T G 16: 34,705,038 S186A probably damaging Het
Cdca4 A G 12: 112,821,547 L187P probably damaging Het
Chil6 T A 3: 106,405,974 K20* probably null Het
Cmss1 A T 16: 57,316,182 L109* probably null Het
Cmtm6 G T 9: 114,731,342 W36L probably benign Het
Cnksr3 T G 10: 7,160,757 I35L possibly damaging Het
Col4a2 G T 8: 11,423,570 G534* probably null Het
Col5a1 T G 2: 28,025,644 V180G probably damaging Het
Ctnna3 T C 10: 63,581,944 F154L probably benign Het
Fabp7 G A 10: 57,785,580 V50M possibly damaging Het
Fam170a T A 18: 50,281,983 V232D probably damaging Het
Fam186a T G 15: 99,945,808 T852P unknown Het
Fam20a T C 11: 109,673,563 I455V probably benign Het
Fbxl6 C T 15: 76,536,804 V324M probably damaging Het
Galnt18 T C 7: 111,779,523 T9A probably damaging Het
Golgb1 T A 16: 36,891,407 M191K possibly damaging Het
Gpld1 A G 13: 24,982,716 T650A probably benign Het
Gprc5d A G 6: 135,116,517 F131L probably benign Het
H2afv C T 11: 6,439,437 G7E unknown Het
Haus4 A T 14: 54,545,835 probably null Het
Helq A G 5: 100,774,163 I725T possibly damaging Het
Igsf23 T A 7: 19,941,830 D117V possibly damaging Het
Kiz A T 2: 146,942,088 S514C probably damaging Het
Klhl6 A T 16: 19,957,033 N258K probably benign Het
Krt72 G C 15: 101,781,073 probably null Het
Large1 A T 8: 73,048,347 I245N probably damaging Het
Lrrc31 T C 3: 30,679,157 I469M probably damaging Het
Lypd4 T A 7: 24,866,696 I68F probably benign Het
Mast1 A G 8: 84,923,779 S442P probably damaging Het
Mmp20 T A 9: 7,645,299 H283Q probably benign Het
Mrps5 G A 2: 127,603,707 V385M possibly damaging Het
Ms4a15 T C 19: 10,979,226 K241E possibly damaging Het
Myt1 A G 2: 181,797,462 E259G probably damaging Het
Myt1l C A 12: 29,895,305 T1023K unknown Het
Ncapd3 T C 9: 27,086,046 L1221P probably damaging Het
Ncoa6 A G 2: 155,407,133 V1417A possibly damaging Het
Nmnat1 A G 4: 149,473,345 V80A possibly damaging Het
Nwd2 A G 5: 63,807,846 E1591G probably benign Het
Olfr1057 A G 2: 86,374,509 L301S possibly damaging Het
Olfr455 A G 6: 42,538,836 F62S probably damaging Het
Osbpl1a A T 18: 12,768,536 probably null Het
Papln T C 12: 83,774,420 I204T probably damaging Het
Phf1 A G 17: 26,934,678 T97A probably benign Het
Plxnb1 A G 9: 109,105,374 D890G probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rbp2 G A 9: 98,507,823 C96Y probably damaging Het
Rgmb A T 17: 15,807,362 M365K possibly damaging Het
Ric1 A G 19: 29,595,536 N792S possibly damaging Het
Ruvbl1 T C 6: 88,497,229 Y405H possibly damaging Het
Scaf4 A G 16: 90,250,307 M394T unknown Het
Siglech T A 7: 55,768,429 C48* probably null Het
Skiv2l A G 17: 34,842,921 V695A possibly damaging Het
Slc2a5 A G 4: 150,140,005 T320A probably benign Het
Slc6a7 T C 18: 61,002,205 Y417C probably benign Het
Sox21 A G 14: 118,234,924 C238R possibly damaging Het
Tbata A T 10: 61,183,353 K109N probably damaging Het
Tecpr2 T G 12: 110,954,730 S1246A probably benign Het
Tekt3 A G 11: 63,081,259 D247G probably benign Het
Tenm3 A T 8: 48,313,236 probably null Het
Thada A T 17: 84,441,104 probably null Het
Tpcn2 C T 7: 145,272,351 G204R probably damaging Het
Tpm2 T C 4: 43,519,220 probably null Het
Trbv24 T C 6: 41,218,092 probably benign Het
Tyw1 A G 5: 130,277,058 R341G probably benign Het
Vmn1r183 T G 7: 24,055,139 N122K probably benign Het
Vmn2r61 T A 7: 42,267,035 H357Q possibly damaging Het
Vps13b C T 15: 35,869,372 T2674I probably damaging Het
Vps13b T C 15: 35,910,293 L3401P probably benign Het
Vps16 T G 2: 130,438,300 probably benign Het
Vrtn T A 12: 84,649,694 I406N probably damaging Het
Vwa8 A T 14: 78,934,613 Y278F probably benign Het
Washc4 A T 10: 83,579,512 I789F possibly damaging Het
Zbtb20 C A 16: 43,618,398 T627K probably damaging Het
Zfyve16 A T 13: 92,522,185 I406K probably benign Het
Zfyve9 A C 4: 108,717,998 S629A possibly damaging Het
Zpld1 A T 16: 55,248,255 N164K probably damaging Het
Other mutations in Adam1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Adam1a APN 5 121519376 missense probably benign 0.09
IGL01467:Adam1a APN 5 121519728 missense probably damaging 1.00
IGL02158:Adam1a APN 5 121518971 nonsense probably null
R1468:Adam1a UTSW 5 121519776 intron probably null
R1468:Adam1a UTSW 5 121519776 intron probably null
R1593:Adam1a UTSW 5 121519643 missense probably benign 0.02
R1848:Adam1a UTSW 5 121519620 missense probably damaging 1.00
R1925:Adam1a UTSW 5 121519450 nonsense probably null
R2176:Adam1a UTSW 5 121519586 missense probably benign 0.01
R2232:Adam1a UTSW 5 121519732 missense possibly damaging 0.93
R3692:Adam1a UTSW 5 121519322 missense probably damaging 1.00
R4732:Adam1a UTSW 5 121519434 missense probably benign 0.34
R4733:Adam1a UTSW 5 121519434 missense probably benign 0.34
R5199:Adam1a UTSW 5 121521152 missense probably benign 0.23
R6026:Adam1a UTSW 5 121519362 missense probably damaging 1.00
R6936:Adam1a UTSW 5 121519362 missense probably damaging 1.00
R7016:Adam1a UTSW 5 121521038 missense probably benign 0.01
R7124:Adam1a UTSW 5 121519334 missense probably benign 0.15
R7294:Adam1a UTSW 5 121520005 nonsense probably null
R7501:Adam1a UTSW 5 121518948 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AAACCGGTTCGCCTTAGTATTAAC -3'
(R):5'- AGCTGCCAATTGTGGGAATG -3'

Sequencing Primer
(F):5'- CTGAAATGTAACATTCCTCAGGGGC -3'
(R):5'- ACTGCGGCAGTGACTGTGAC -3'
Posted On2016-03-01