Incidental Mutation 'R4835:Tpcn2'
ID373158
Institutional Source Beutler Lab
Gene Symbol Tpcn2
Ensembl Gene ENSMUSG00000048677
Gene Nametwo pore segment channel 2
Synonyms
MMRRC Submission 042450-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4835 (G1)
Quality Score101
Status Validated
Chromosome7
Chromosomal Location145186524-145284011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 145272351 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 204 (G204R)
Ref Sequence ENSEMBL: ENSMUSP00000147224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058022] [ENSMUST00000208148] [ENSMUST00000208328] [ENSMUST00000208841] [ENSMUST00000209047] [ENSMUST00000209156]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058022
AA Change: G204R

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000061308
Gene: ENSMUSG00000048677
AA Change: G204R

DomainStartEndE-ValueType
Pfam:Ion_trans 67 302 5.1e-24 PFAM
Pfam:Ion_trans 415 683 1.5e-29 PFAM
low complexity region 709 729 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208148
AA Change: G180R

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000208328
AA Change: G204R

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208841
AA Change: G204R

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000209047
AA Change: G204R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000209156
Meta Mutation Damage Score 0.2883 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative cation-selective ion channel with two repeats of a six-transmembrane-domain. The protein localizes to lysosomal membranes and enables nicotinic acid adenine dinucleotide phosphate (NAADP) -induced calcium ion release from lysosome-related stores. This ubiquitously expressed gene has elevated expression in liver and kidney. Two common nonsynonymous SNPs in this gene strongly associate with blond versus brown hair pigmentation.[provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit altered beta cell calcium ion physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,574,901 noncoding transcript Het
4933434E20Rik A G 3: 90,063,209 N17D probably benign Het
A1bg T C 15: 60,920,251 D176G probably benign Het
Abcg5 A T 17: 84,658,648 M428K possibly damaging Het
Adam1a A T 5: 121,519,689 C514S probably damaging Het
Angptl3 A G 4: 99,037,412 Q325R probably benign Het
Ankrd26 C T 6: 118,548,850 W378* probably null Het
Apob T C 12: 8,015,391 V4087A possibly damaging Het
Auts2 A G 5: 131,466,093 I117T probably damaging Het
AW146154 T A 7: 41,480,468 E408V probably damaging Het
Bicd1 A T 6: 149,484,090 N107I probably benign Het
Blm T C 7: 80,509,546 S281G probably benign Het
Btaf1 T A 19: 37,002,458 D1542E probably benign Het
C2cd2l A G 9: 44,315,145 probably null Het
Capn8 C A 1: 182,604,551 N362K probably damaging Het
Ccdc14 T G 16: 34,705,038 S186A probably damaging Het
Cdca4 A G 12: 112,821,547 L187P probably damaging Het
Chil6 T A 3: 106,405,974 K20* probably null Het
Cmss1 A T 16: 57,316,182 L109* probably null Het
Cmtm6 G T 9: 114,731,342 W36L probably benign Het
Cnksr3 T G 10: 7,160,757 I35L possibly damaging Het
Col4a2 G T 8: 11,423,570 G534* probably null Het
Col5a1 T G 2: 28,025,644 V180G probably damaging Het
Ctnna3 T C 10: 63,581,944 F154L probably benign Het
Fabp7 G A 10: 57,785,580 V50M possibly damaging Het
Fam170a T A 18: 50,281,983 V232D probably damaging Het
Fam186a T G 15: 99,945,808 T852P unknown Het
Fam20a T C 11: 109,673,563 I455V probably benign Het
Fbxl6 C T 15: 76,536,804 V324M probably damaging Het
Galnt18 T C 7: 111,779,523 T9A probably damaging Het
Golgb1 T A 16: 36,891,407 M191K possibly damaging Het
Gpld1 A G 13: 24,982,716 T650A probably benign Het
Gprc5d A G 6: 135,116,517 F131L probably benign Het
H2afv C T 11: 6,439,437 G7E unknown Het
Haus4 A T 14: 54,545,835 probably null Het
Helq A G 5: 100,774,163 I725T possibly damaging Het
Igsf23 T A 7: 19,941,830 D117V possibly damaging Het
Kiz A T 2: 146,942,088 S514C probably damaging Het
Klhl6 A T 16: 19,957,033 N258K probably benign Het
Krt72 G C 15: 101,781,073 probably null Het
Large1 A T 8: 73,048,347 I245N probably damaging Het
Lrrc31 T C 3: 30,679,157 I469M probably damaging Het
Lypd4 T A 7: 24,866,696 I68F probably benign Het
Mast1 A G 8: 84,923,779 S442P probably damaging Het
Mmp20 T A 9: 7,645,299 H283Q probably benign Het
Mrps5 G A 2: 127,603,707 V385M possibly damaging Het
Ms4a15 T C 19: 10,979,226 K241E possibly damaging Het
Myt1 A G 2: 181,797,462 E259G probably damaging Het
Myt1l C A 12: 29,895,305 T1023K unknown Het
Ncapd3 T C 9: 27,086,046 L1221P probably damaging Het
Ncoa6 A G 2: 155,407,133 V1417A possibly damaging Het
Nmnat1 A G 4: 149,473,345 V80A possibly damaging Het
Nwd2 A G 5: 63,807,846 E1591G probably benign Het
Olfr1057 A G 2: 86,374,509 L301S possibly damaging Het
Olfr455 A G 6: 42,538,836 F62S probably damaging Het
Osbpl1a A T 18: 12,768,536 probably null Het
Papln T C 12: 83,774,420 I204T probably damaging Het
Phf1 A G 17: 26,934,678 T97A probably benign Het
Plxnb1 A G 9: 109,105,374 D890G probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rbp2 G A 9: 98,507,823 C96Y probably damaging Het
Rgmb A T 17: 15,807,362 M365K possibly damaging Het
Ric1 A G 19: 29,595,536 N792S possibly damaging Het
Ruvbl1 T C 6: 88,497,229 Y405H possibly damaging Het
Scaf4 A G 16: 90,250,307 M394T unknown Het
Siglech T A 7: 55,768,429 C48* probably null Het
Skiv2l A G 17: 34,842,921 V695A possibly damaging Het
Slc2a5 A G 4: 150,140,005 T320A probably benign Het
Slc6a7 T C 18: 61,002,205 Y417C probably benign Het
Sox21 A G 14: 118,234,924 C238R possibly damaging Het
Tbata A T 10: 61,183,353 K109N probably damaging Het
Tecpr2 T G 12: 110,954,730 S1246A probably benign Het
Tekt3 A G 11: 63,081,259 D247G probably benign Het
Tenm3 A T 8: 48,313,236 probably null Het
Thada A T 17: 84,441,104 probably null Het
Tpm2 T C 4: 43,519,220 probably null Het
Trbv24 T C 6: 41,218,092 probably benign Het
Tyw1 A G 5: 130,277,058 R341G probably benign Het
Vmn1r183 T G 7: 24,055,139 N122K probably benign Het
Vmn2r61 T A 7: 42,267,035 H357Q possibly damaging Het
Vps13b C T 15: 35,869,372 T2674I probably damaging Het
Vps13b T C 15: 35,910,293 L3401P probably benign Het
Vps16 T G 2: 130,438,300 probably benign Het
Vrtn T A 12: 84,649,694 I406N probably damaging Het
Vwa8 A T 14: 78,934,613 Y278F probably benign Het
Washc4 A T 10: 83,579,512 I789F possibly damaging Het
Zbtb20 C A 16: 43,618,398 T627K probably damaging Het
Zfyve16 A T 13: 92,522,185 I406K probably benign Het
Zfyve9 A C 4: 108,717,998 S629A possibly damaging Het
Zpld1 A T 16: 55,248,255 N164K probably damaging Het
Other mutations in Tpcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Tpcn2 APN 7 145267378 missense probably damaging 1.00
IGL02112:Tpcn2 APN 7 145256792 missense probably benign 0.18
IGL02646:Tpcn2 APN 7 145258574 missense probably benign 0.03
R0385:Tpcn2 UTSW 7 145277174 missense probably damaging 1.00
R1441:Tpcn2 UTSW 7 145260134 missense probably benign
R1498:Tpcn2 UTSW 7 145268911 missense probably damaging 1.00
R1598:Tpcn2 UTSW 7 145277220 nonsense probably null
R2127:Tpcn2 UTSW 7 145273975 splice site probably benign
R2354:Tpcn2 UTSW 7 145257218 missense probably damaging 1.00
R3747:Tpcn2 UTSW 7 145255523 missense probably damaging 0.97
R3748:Tpcn2 UTSW 7 145255523 missense probably damaging 0.97
R3749:Tpcn2 UTSW 7 145255523 missense probably damaging 0.97
R4775:Tpcn2 UTSW 7 145267342 missense probably damaging 1.00
R4931:Tpcn2 UTSW 7 145267309 missense probably benign 0.34
R4979:Tpcn2 UTSW 7 145260096 missense probably benign
R5185:Tpcn2 UTSW 7 145255454 missense probably damaging 1.00
R5418:Tpcn2 UTSW 7 145278781 missense probably damaging 1.00
R5443:Tpcn2 UTSW 7 145255472 missense possibly damaging 0.46
R5623:Tpcn2 UTSW 7 145267334 missense possibly damaging 0.76
R5716:Tpcn2 UTSW 7 145257813 missense possibly damaging 0.94
R5910:Tpcn2 UTSW 7 145260982 missense probably benign 0.01
R5927:Tpcn2 UTSW 7 145278784 missense probably damaging 0.99
R6015:Tpcn2 UTSW 7 145266851 missense probably damaging 1.00
R6036:Tpcn2 UTSW 7 145268869 missense possibly damaging 0.93
R6036:Tpcn2 UTSW 7 145268869 missense possibly damaging 0.93
R6299:Tpcn2 UTSW 7 145262243 missense probably damaging 1.00
R6337:Tpcn2 UTSW 7 145279343 missense probably damaging 1.00
R6382:Tpcn2 UTSW 7 145269749 missense possibly damaging 0.88
R6724:Tpcn2 UTSW 7 145256520 missense probably benign 0.00
R6995:Tpcn2 UTSW 7 145256785 missense probably benign 0.00
R7494:Tpcn2 UTSW 7 145278849 missense possibly damaging 0.91
R7942:Tpcn2 UTSW 7 145257191 missense probably damaging 0.99
R8052:Tpcn2 UTSW 7 145260946 missense probably benign 0.06
R8320:Tpcn2 UTSW 7 145266622 missense possibly damaging 0.75
Y4335:Tpcn2 UTSW 7 145257235 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCATGACACACTTCCTGGTC -3'
(R):5'- AAGTGACCTCTGTCCTCTGTG -3'

Sequencing Primer
(F):5'- GACACACTTCCTGGTCTGTTACAGG -3'
(R):5'- TGTGTCCTACCACAAATAGAGAAGTC -3'
Posted On2016-03-01