Mutagenetix > Incidental Mutations

Incidental Mutation 'R4835:Abcg5'

373198

Institutional Source

Beutler Lab

Gene Symbol

Abcg5

Ensembl Gene

ENSMUSG00000040505

Gene Name

ATP binding cassette subfamily G member 5

Synonyms

Sterolin-1, cmp, trac

MMRRC Submission

042450-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.394) question?

Stock #

R4835 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84658234-84683011 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 84658648 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 428 (M428K)

Ref Sequence

ENSEMBL: ENSMUSP00000130783 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025101] [ENSMUST00000066175] [ENSMUST00000163375]

AlphaFold

Q99PE8

Predicted Effect

probably benign
Transcript: ENSMUST00000025101

SMART Domains

Protein: ENSMUSP00000025101
Gene: ENSMUSG00000024253

Domain	Start	End	E-Value	Type
Pfam:DLIC	2	179	3.3e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000066175
AA Change: M600K

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000069495
Gene: ENSMUSG00000040505
AA Change: M600K

Domain	Start	End	E-Value	Type
AAA	79	271	2.28e-11	SMART
Pfam:ABC2_membrane	367	581	1.3e-24	PFAM
transmembrane domain	621	643	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163375
AA Change: M428K

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000130783
Gene: ENSMUSG00000040505
AA Change: M428K

Domain	Start	End	E-Value	Type
Pfam:ABC_tran	1	134	7.8e-17	PFAM
Pfam:ABC2_membrane	195	409	1.4e-23	PFAM
transmembrane domain	449	471	N/A	INTRINSIC

Meta Mutation Damage Score

0.1077

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

98% (96/98)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily, and functions as a half-transporter to limit intestinal absorption and promote biliary excretion of sterols. Disruption of this gene in mice results in thrombocytopenia, prolonged bleeding times, anemia, leukopenia, infertility, shortened life span and cardiomyopathy. Mice lacking this gene show symptoms of sitosterolemia. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes for a null allele show hyperabsorption of dietary plant sterols and sitosterolemia. Spontaneous mutants are small, infertile and hunched and display anemia, leukopenia, macrothrombocytopenia, other hematologic defects, cardiomyopathy, high plasma phytosterol levels and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	T	7: 29,574,901		noncoding transcript	Het
4933434E20Rik	A	G	3: 90,063,209	N17D	probably benign	Het
A1bg	T	C	15: 60,920,251	D176G	probably benign	Het
Adam1a	A	T	5: 121,519,689	C514S	probably damaging	Het
Angptl3	A	G	4: 99,037,412	Q325R	probably benign	Het
Ankrd26	C	T	6: 118,548,850	W378*	probably null	Het
Apob	T	C	12: 8,015,391	V4087A	possibly damaging	Het
Auts2	A	G	5: 131,466,093	I117T	probably damaging	Het
AW146154	T	A	7: 41,480,468	E408V	probably damaging	Het
Bicd1	A	T	6: 149,484,090	N107I	probably benign	Het
Blm	T	C	7: 80,509,546	S281G	probably benign	Het
Btaf1	T	A	19: 37,002,458	D1542E	probably benign	Het
C2cd2l	A	G	9: 44,315,145		probably null	Het
Capn8	C	A	1: 182,604,551	N362K	probably damaging	Het
Ccdc14	T	G	16: 34,705,038	S186A	probably damaging	Het
Cdca4	A	G	12: 112,821,547	L187P	probably damaging	Het
Chil6	T	A	3: 106,405,974	K20*	probably null	Het
Cmss1	A	T	16: 57,316,182	L109*	probably null	Het
Cmtm6	G	T	9: 114,731,342	W36L	probably benign	Het
Cnksr3	T	G	10: 7,160,757	I35L	possibly damaging	Het
Col4a2	G	T	8: 11,423,570	G534*	probably null	Het
Col5a1	T	G	2: 28,025,644	V180G	probably damaging	Het
Ctnna3	T	C	10: 63,581,944	F154L	probably benign	Het
Fabp7	G	A	10: 57,785,580	V50M	possibly damaging	Het
Fam170a	T	A	18: 50,281,983	V232D	probably damaging	Het
Fam186a	T	G	15: 99,945,808	T852P	unknown	Het
Fam20a	T	C	11: 109,673,563	I455V	probably benign	Het
Fbxl6	C	T	15: 76,536,804	V324M	probably damaging	Het
Galnt18	T	C	7: 111,779,523	T9A	probably damaging	Het
Golgb1	T	A	16: 36,891,407	M191K	possibly damaging	Het
Gpld1	A	G	13: 24,982,716	T650A	probably benign	Het
Gprc5d	A	G	6: 135,116,517	F131L	probably benign	Het
H2afv	C	T	11: 6,439,437	G7E	unknown	Het
Haus4	A	T	14: 54,545,835		probably null	Het
Helq	A	G	5: 100,774,163	I725T	possibly damaging	Het
Igsf23	T	A	7: 19,941,830	D117V	possibly damaging	Het
Kiz	A	T	2: 146,942,088	S514C	probably damaging	Het
Klhl6	A	T	16: 19,957,033	N258K	probably benign	Het
Krt72	G	C	15: 101,781,073		probably null	Het
Large1	A	T	8: 73,048,347	I245N	probably damaging	Het
Lrrc31	T	C	3: 30,679,157	I469M	probably damaging	Het
Lypd4	T	A	7: 24,866,696	I68F	probably benign	Het
Mast1	A	G	8: 84,923,779	S442P	probably damaging	Het
Mmp20	T	A	9: 7,645,299	H283Q	probably benign	Het
Mrps5	G	A	2: 127,603,707	V385M	possibly damaging	Het
Ms4a15	T	C	19: 10,979,226	K241E	possibly damaging	Het
Myt1	A	G	2: 181,797,462	E259G	probably damaging	Het
Myt1l	C	A	12: 29,895,305	T1023K	unknown	Het
Ncapd3	T	C	9: 27,086,046	L1221P	probably damaging	Het
Ncoa6	A	G	2: 155,407,133	V1417A	possibly damaging	Het
Nmnat1	A	G	4: 149,473,345	V80A	possibly damaging	Het
Nwd2	A	G	5: 63,807,846	E1591G	probably benign	Het
Olfr1057	A	G	2: 86,374,509	L301S	possibly damaging	Het
Olfr455	A	G	6: 42,538,836	F62S	probably damaging	Het
Osbpl1a	A	T	18: 12,768,536		probably null	Het
Papln	T	C	12: 83,774,420	I204T	probably damaging	Het
Phf1	A	G	17: 26,934,678	T97A	probably benign	Het
Plxnb1	A	G	9: 109,105,374	D890G	probably damaging	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Ptgir	A	G	7: 16,906,869	M29V	possibly damaging	Het
Rbp2	G	A	9: 98,507,823	C96Y	probably damaging	Het
Rgmb	A	T	17: 15,807,362	M365K	possibly damaging	Het
Ric1	A	G	19: 29,595,536	N792S	possibly damaging	Het
Ruvbl1	T	C	6: 88,497,229	Y405H	possibly damaging	Het
Scaf4	A	G	16: 90,250,307	M394T	unknown	Het
Siglech	T	A	7: 55,768,429	C48*	probably null	Het
Skiv2l	A	G	17: 34,842,921	V695A	possibly damaging	Het
Slc2a5	A	G	4: 150,140,005	T320A	probably benign	Het
Slc6a7	T	C	18: 61,002,205	Y417C	probably benign	Het
Sox21	A	G	14: 118,234,924	C238R	possibly damaging	Het
Tbata	A	T	10: 61,183,353	K109N	probably damaging	Het
Tecpr2	T	G	12: 110,954,730	S1246A	probably benign	Het
Tekt3	A	G	11: 63,081,259	D247G	probably benign	Het
Tenm3	A	T	8: 48,313,236		probably null	Het
Thada	A	T	17: 84,441,104		probably null	Het
Tpcn2	C	T	7: 145,272,351	G204R	probably damaging	Het
Tpm2	T	C	4: 43,519,220		probably null	Het
Trbv24	T	C	6: 41,218,092		probably benign	Het
Tyw1	A	G	5: 130,277,058	R341G	probably benign	Het
Vmn1r183	T	G	7: 24,055,139	N122K	probably benign	Het
Vmn2r61	T	A	7: 42,267,035	H357Q	possibly damaging	Het
Vps13b	C	T	15: 35,869,372	T2674I	probably damaging	Het
Vps13b	T	C	15: 35,910,293	L3401P	probably benign	Het
Vps16	T	G	2: 130,438,300		probably benign	Het
Vrtn	T	A	12: 84,649,694	I406N	probably damaging	Het
Vwa8	A	T	14: 78,934,613	Y278F	probably benign	Het
Washc4	A	T	10: 83,579,512	I789F	possibly damaging	Het
Zbtb20	C	A	16: 43,618,398	T627K	probably damaging	Het
Zfyve16	A	T	13: 92,522,185	I406K	probably benign	Het
Zfyve9	A	C	4: 108,717,998	S629A	possibly damaging	Het
Zpld1	A	T	16: 55,248,255	N164K	probably damaging	Het

Other mutations in Abcg5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01138:Abcg5	APN	17	84664847	missense	possibly damaging	0.73
IGL01844:Abcg5	APN	17	84682025	missense	probably damaging	1.00
IGL02002:Abcg5	APN	17	84682051	nonsense	probably null
IGL02116:Abcg5	APN	17	84673590	missense	possibly damaging	0.67
IGL02339:Abcg5	APN	17	84673604	missense	possibly damaging	0.95
IGL02568:Abcg5	APN	17	84670399	missense	probably damaging	0.99
PIT4142001:Abcg5	UTSW	17	84673594	missense	possibly damaging	0.59
R0539:Abcg5	UTSW	17	84669075	missense	probably benign	0.01
R1104:Abcg5	UTSW	17	84682049	missense	possibly damaging	0.78
R1795:Abcg5	UTSW	17	84673579	missense	probably damaging	1.00
R1956:Abcg5	UTSW	17	84670375	missense	probably damaging	1.00
R1970:Abcg5	UTSW	17	84673602	frame shift	probably null
R2007:Abcg5	UTSW	17	84669920	missense	probably damaging	1.00
R2118:Abcg5	UTSW	17	84671147	missense	probably benign	0.06
R2120:Abcg5	UTSW	17	84671147	missense	probably benign	0.06
R2121:Abcg5	UTSW	17	84671147	missense	probably benign	0.06
R2122:Abcg5	UTSW	17	84671147	missense	probably benign	0.06
R2124:Abcg5	UTSW	17	84671147	missense	probably benign	0.06
R2858:Abcg5	UTSW	17	84670220	critical splice donor site	probably null
R3121:Abcg5	UTSW	17	84658663	missense	probably benign	0.33
R4694:Abcg5	UTSW	17	84672158	missense	probably damaging	1.00
R4963:Abcg5	UTSW	17	84660141	nonsense	probably null
R5187:Abcg5	UTSW	17	84658564	missense	probably damaging	1.00
R5348:Abcg5	UTSW	17	84671206	missense	possibly damaging	0.92
R5445:Abcg5	UTSW	17	84671129	missense	probably damaging	1.00
R5580:Abcg5	UTSW	17	84660154	missense	probably damaging	1.00
R5807:Abcg5	UTSW	17	84672291	missense	probably damaging	0.99
R6007:Abcg5	UTSW	17	84668964	missense	probably benign	0.01
R7303:Abcg5	UTSW	17	84670346	missense	probably damaging	1.00
R7324:Abcg5	UTSW	17	84676239	missense	possibly damaging	0.82
R7639:Abcg5	UTSW	17	84670103	missense	probably benign
R7844:Abcg5	UTSW	17	84673590	missense	possibly damaging	0.67
R7996:Abcg5	UTSW	17	84670062	missense	probably damaging	1.00
R8083:Abcg5	UTSW	17	84658543	missense	probably damaging	1.00
R8103:Abcg5	UTSW	17	84658528	missense	possibly damaging	0.49
R8258:Abcg5	UTSW	17	84676095	missense	possibly damaging	0.88
R8259:Abcg5	UTSW	17	84676095	missense	possibly damaging	0.88
R8831:Abcg5	UTSW	17	84668995	missense	probably damaging	1.00
R8871:Abcg5	UTSW	17	84682867	missense	probably benign	0.01
R8921:Abcg5	UTSW	17	84682825	missense	probably benign	0.01
R9123:Abcg5	UTSW	17	84668997	missense	probably damaging	1.00
R9125:Abcg5	UTSW	17	84668997	missense	probably damaging	1.00
R9291:Abcg5	UTSW	17	84668952	missense	probably benign	0.07
Z1177:Abcg5	UTSW	17	84676271	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGTAGACAGTACTTCTCTGTGC -3'
(R):5'- TCTGGGTTCTCCGAACACTG -3'

Sequencing Primer
(F):5'- GCGTGCCTGCCCATTAAC -3'
(R):5'- CCGAACACTGTGTGTCTTTCATGAAG -3'

Posted On

2016-03-01