Incidental Mutation 'R4836:D6Ertd527e'
ID 373233
Institutional Source Beutler Lab
Gene Symbol D6Ertd527e
Ensembl Gene ENSMUSG00000090891
Gene Name DNA segment, Chr 6, ERATO Doi 527, expressed
MMRRC Submission 042451-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock # R4836 (G1)
Quality Score 217
Status Validated
Chromosome 6
Chromosomal Location 87104746-87112997 bp(+) (GRCm38)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) GGCAGCAGCAGCA to GGCAGCAGCAGCAGCA at 87111424 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170124] [ENSMUST00000203747] [ENSMUST00000204927]
AlphaFold A0A0N4SWI3
Predicted Effect probably benign
Transcript: ENSMUST00000170124
SMART Domains Protein: ENSMUSP00000130803
Gene: ENSMUSG00000090891

low complexity region 7 183 N/A INTRINSIC
internal_repeat_1 186 207 1.15e-33 PROSPERO
low complexity region 212 243 N/A INTRINSIC
internal_repeat_2 244 254 2.22e-11 PROSPERO
internal_repeat_2 260 270 2.22e-11 PROSPERO
low complexity region 272 294 N/A INTRINSIC
internal_repeat_1 297 318 1.15e-33 PROSPERO
low complexity region 323 459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203725
Predicted Effect probably benign
Transcript: ENSMUST00000203747
SMART Domains Protein: ENSMUSP00000144761
Gene: ENSMUSG00000090891

low complexity region 5 182 N/A INTRINSIC
internal_repeat_1 185 206 1.04e-33 PROSPERO
low complexity region 211 242 N/A INTRINSIC
internal_repeat_2 243 253 2.12e-11 PROSPERO
internal_repeat_2 259 269 2.12e-11 PROSPERO
low complexity region 271 293 N/A INTRINSIC
internal_repeat_1 296 317 1.04e-33 PROSPERO
low complexity region 322 458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204927
SMART Domains Protein: ENSMUSP00000145529
Gene: ENSMUSG00000090891

low complexity region 7 183 N/A INTRINSIC
internal_repeat_1 186 207 1.15e-33 PROSPERO
low complexity region 212 243 N/A INTRINSIC
internal_repeat_2 244 254 2.22e-11 PROSPERO
internal_repeat_2 260 270 2.22e-11 PROSPERO
low complexity region 272 294 N/A INTRINSIC
internal_repeat_1 297 318 1.15e-33 PROSPERO
low complexity region 323 459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205257
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 98% (87/89)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,299,108 I1051T probably benign Het
Acox1 A T 11: 116,175,326 S453T probably benign Het
AF366264 C T 8: 13,838,007 S28N probably benign Het
Ahnak2 A T 12: 112,774,116 V368D probably damaging Het
Ankrd53 A T 6: 83,768,152 Y448F probably damaging Het
Arhgef15 A T 11: 68,949,925 probably benign Het
Atg2b T C 12: 105,646,814 N1166S probably benign Het
Atl3 C T 19: 7,509,545 R77* probably null Het
Bend6 T C 1: 33,883,573 probably benign Het
Ccnt1 C A 15: 98,567,563 R25L probably damaging Het
Cct4 A G 11: 23,002,898 T525A probably benign Het
Cep350 T C 1: 155,928,833 I835V probably damaging Het
Clcn1 G T 6: 42,309,964 V652L probably damaging Het
Cntln T A 4: 85,049,720 Y725* probably null Het
Cog5 T C 12: 31,919,733 F21L probably benign Het
Dnm2 A T 9: 21,491,330 probably benign Het
Dnmt1 C T 9: 20,908,558 V1430I probably damaging Het
Dpep1 A G 8: 123,200,367 D285G probably damaging Het
Eef2kmt C T 16: 5,249,003 V129M probably damaging Het
Epha3 A T 16: 63,583,557 M726K probably damaging Het
Fat3 A G 9: 16,377,723 L168P probably damaging Het
Frem3 T A 8: 80,663,397 F1759Y probably damaging Het
Fubp3 T A 2: 31,608,141 S56R possibly damaging Het
Gm1965 T C 6: 89,145,410 noncoding transcript Het
Gm5592 C T 7: 41,215,534 probably benign Het
Hils1 T A 11: 94,968,017 L46* probably null Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 913 probably null Het
Isl1 A G 13: 116,303,083 M243T probably benign Het
Itpr1 A T 6: 108,389,537 I142F probably damaging Het
Jak1 T C 4: 101,155,066 T1069A probably damaging Het
Jmjd1c T C 10: 67,233,446 V1848A probably benign Het
Kdm5a T C 6: 120,412,402 V930A probably damaging Het
Kdm5b C A 1: 134,593,315 probably null Het
Lexm T A 4: 106,610,527 probably null Het
Lilra5 T C 7: 4,238,714 F171L possibly damaging Het
Map1b A G 13: 99,431,054 S1720P unknown Het
Mcpt1 A T 14: 56,019,560 Q185L probably damaging Het
Mmp20 T A 9: 7,644,026 D238E possibly damaging Het
Mov10l1 A T 15: 89,020,269 I784F possibly damaging Het
Mroh2b C T 15: 4,904,270 P101S probably damaging Het
Myh3 G T 11: 67,096,939 A1413S probably benign Het
Nat6 A T 9: 107,583,539 Y211F probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr1009 A G 2: 85,721,449 I15V probably benign Het
Olfr1054 A T 2: 86,333,227 M43K probably benign Het
Olfr1056 G A 2: 86,355,750 L211F probably benign Het
Olfr1196 A G 2: 88,701,200 I43T probably damaging Het
Olfr330 A C 11: 58,529,482 M168R probably damaging Het
Olfr533 A G 7: 140,467,076 R292G probably damaging Het
Palld T A 8: 61,687,381 T531S probably benign Het
Parp4 A G 14: 56,585,738 E105G probably benign Het
Phf11a A T 14: 59,287,579 S59T probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Rad50 A T 11: 53,650,653 I1252N probably damaging Het
Ramp3 A G 11: 6,674,761 probably null Het
Rrbp1 G A 2: 143,988,417 T610I possibly damaging Het
Slc4a10 A G 2: 62,268,187 Y555C probably damaging Het
Slc5a2 A G 7: 128,267,505 probably null Het
Smoc1 T A 12: 81,179,548 D371E probably damaging Het
Stmn1 T A 4: 134,470,184 probably benign Het
Sulf1 C T 1: 12,842,686 L715F probably benign Het
Surf1 T C 2: 26,914,243 T180A possibly damaging Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tchh A T 3: 93,445,148 R632W unknown Het
Tchh A T 3: 93,447,588 D1445V unknown Het
Tctn1 A T 5: 122,245,505 M505K probably benign Het
Tdrkh T A 3: 94,425,590 I150N probably damaging Het
Tespa1 C T 10: 130,362,159 T350I probably benign Het
Thbs1 A G 2: 118,115,018 Y326C possibly damaging Het
Tmem208 C T 8: 105,328,664 S119F probably damaging Het
Tmprss6 G C 15: 78,445,388 A91G probably damaging Het
Trp53bp2 C T 1: 182,431,582 R67W probably damaging Het
Ttn A G 2: 76,711,197 I25488T possibly damaging Het
Txnl4a A G 18: 80,222,253 E111G probably damaging Het
Unc13b T G 4: 43,237,137 I3402M probably damaging Het
Vmn1r188 A C 13: 22,088,121 I82L probably benign Het
Zfp65 A G 13: 67,708,875 V95A probably benign Het
Zfp985 T A 4: 147,584,155 S493R probably damaging Het
Other mutations in D6Ertd527e
AlleleSourceChrCoordTypePredicted EffectPPH Score
Bursting UTSW 6 87111317 missense unknown
R0739_D6Ertd527e_618 UTSW 6 87111668 missense unknown
sonenschein UTSW 6 87111524 missense unknown
R0325:D6Ertd527e UTSW 6 87111295 missense unknown
R0415:D6Ertd527e UTSW 6 87111524 missense unknown
R0607:D6Ertd527e UTSW 6 87111905 missense unknown
R0739:D6Ertd527e UTSW 6 87111668 missense unknown
R0992:D6Ertd527e UTSW 6 87111524 missense unknown
R0993:D6Ertd527e UTSW 6 87111524 missense unknown
R1193:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1196:D6Ertd527e UTSW 6 87111524 missense unknown
R1386:D6Ertd527e UTSW 6 87111524 missense unknown
R1413:D6Ertd527e UTSW 6 87111353 missense unknown
R1485:D6Ertd527e UTSW 6 87111085 missense unknown
R1560:D6Ertd527e UTSW 6 87111524 missense unknown
R1561:D6Ertd527e UTSW 6 87111524 missense unknown
R1568:D6Ertd527e UTSW 6 87111524 missense unknown
R2290:D6Ertd527e UTSW 6 87111545 missense unknown
R4155:D6Ertd527e UTSW 6 87111524 missense unknown
R4461:D6Ertd527e UTSW 6 87111317 missense unknown
R5102:D6Ertd527e UTSW 6 87111811 missense unknown
R5149:D6Ertd527e UTSW 6 87111524 missense unknown
R5150:D6Ertd527e UTSW 6 87111524 missense unknown
R5681:D6Ertd527e UTSW 6 87111206 missense unknown
R6250:D6Ertd527e UTSW 6 87111212 missense unknown
R6398:D6Ertd527e UTSW 6 87111524 missense unknown
R6441:D6Ertd527e UTSW 6 87111524 missense unknown
R7001:D6Ertd527e UTSW 6 87111212 missense unknown
R7142:D6Ertd527e UTSW 6 87111524 missense unknown
R7297:D6Ertd527e UTSW 6 87111524 missense unknown
R7821:D6Ertd527e UTSW 6 87110897 missense unknown
R8047:D6Ertd527e UTSW 6 87111472 missense unknown
R8827:D6Ertd527e UTSW 6 87111244 missense unknown
R9038:D6Ertd527e UTSW 6 87112251 makesense probably null
S24628:D6Ertd527e UTSW 6 87111524 missense unknown
V1662:D6Ertd527e UTSW 6 87111892 missense unknown
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2016-03-01