Mutagenetix > Incidental Mutation

Incidental Mutation 'R4836:Itpr1'

373235

Institutional Source

Beutler Lab

Gene Symbol

Itpr1

Ensembl Gene

ENSMUSG00000030102

Gene Name

inositol 1,4,5-trisphosphate receptor 1

Synonyms

P400, Itpr-1, IP3R1, Pcp1, Pcp-1, Ip3r, InsP3R type I, opt

MMRRC Submission

042451-MU

Accession Numbers

NCBI RefSeq: NM_010585.5; MGI: 96623

Essential gene?

Probably essential (E-score: 0.797) question?

Stock #

R4836 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108213096-108551109 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 108389537 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 142 (I142F)

Ref Sequence

ENSEMBL: ENSMUSP00000148284 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203615] [ENSMUST00000212125]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032192
AA Change: I974F

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: I974F

Domain	Start	End	E-Value	Type
MIR	112	166	7.99e-8	SMART
MIR	173	223	1.02e-5	SMART
MIR	231	287	2.33e-9	SMART
MIR	294	403	5.95e-16	SMART
Pfam:RYDR_ITPR	474	670	2.3e-61	PFAM
low complexity region	683	695	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	1004	1020	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1344	1.9e-14	PFAM
low complexity region	1758	1787	N/A	INTRINSIC
Pfam:RIH_assoc	1959	2069	1.2e-33	PFAM
transmembrane domain	2274	2296	N/A	INTRINSIC
Pfam:Ion_trans	2311	2600	9e-22	PFAM
coiled coil region	2683	2732	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000203615
AA Change: I974F

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: I974F

Domain	Start	End	E-Value	Type
MIR	112	166	7.99e-8	SMART
MIR	173	223	1.02e-5	SMART
MIR	231	287	2.33e-9	SMART
MIR	294	403	5.95e-16	SMART
Pfam:RYDR_ITPR	474	670	2.3e-61	PFAM
low complexity region	683	695	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	1004	1020	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1344	1.9e-14	PFAM
low complexity region	1757	1786	N/A	INTRINSIC
Pfam:RIH_assoc	1958	2068	1.2e-33	PFAM
transmembrane domain	2273	2295	N/A	INTRINSIC
Pfam:Ion_trans	2310	2599	9e-22	PFAM
coiled coil region	2682	2731	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203995

Predicted Effect

probably damaging
Transcript: ENSMUST00000212125
AA Change: I142F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

Meta Mutation Damage Score

0.5024

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

98% (87/89)

MGI Phenotype

Strain: 2180360; 3715928; 1856981
Lethality: D10-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]

Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830411N06Rik	T	C	7: 140,299,108	I1051T	probably benign	Het
Acox1	A	T	11: 116,175,326	S453T	probably benign	Het
AF366264	C	T	8: 13,838,007	S28N	probably benign	Het
Ahnak2	A	T	12: 112,774,116	V368D	probably damaging	Het
Ankrd53	A	T	6: 83,768,152	Y448F	probably damaging	Het
Arhgef15	A	T	11: 68,949,925		probably benign	Het
Atg2b	T	C	12: 105,646,814	N1166S	probably benign	Het
Atl3	C	T	19: 7,509,545	R77*	probably null	Het
Bend6	T	C	1: 33,883,573		probably benign	Het
Ccnt1	C	A	15: 98,567,563	R25L	probably damaging	Het
Cct4	A	G	11: 23,002,898	T525A	probably benign	Het
Cep350	T	C	1: 155,928,833	I835V	probably damaging	Het
Clcn1	G	T	6: 42,309,964	V652L	probably damaging	Het
Cntln	T	A	4: 85,049,720	Y725*	probably null	Het
Cog5	T	C	12: 31,919,733	F21L	probably benign	Het
D6Ertd527e	GGCAGCAGCAGCA	GGCAGCAGCAGCAGCA	6: 87,111,424		probably benign	Het
Dnm2	A	T	9: 21,491,330		probably benign	Het
Dnmt1	C	T	9: 20,908,558	V1430I	probably damaging	Het
Dpep1	A	G	8: 123,200,367	D285G	probably damaging	Het
Eef2kmt	C	T	16: 5,249,003	V129M	probably damaging	Het
Epha3	A	T	16: 63,583,557	M726K	probably damaging	Het
Fat3	A	G	9: 16,377,723	L168P	probably damaging	Het
Frem3	T	A	8: 80,663,397	F1759Y	probably damaging	Het
Fubp3	T	A	2: 31,608,141	S56R	possibly damaging	Het
Gm1965	T	C	6: 89,145,410		noncoding transcript	Het
Gm5592	C	T	7: 41,215,534		probably benign	Het
Hils1	T	A	11: 94,968,017	L46*	probably null	Het
Irs1	TGGGGTGGACATCGAACTGAAGGAG	TG	1: 82,287,732	913	probably null	Het
Isl1	A	G	13: 116,303,083	M243T	probably benign	Het
Jak1	T	C	4: 101,155,066	T1069A	probably damaging	Het
Jmjd1c	T	C	10: 67,233,446	V1848A	probably benign	Het
Kdm5a	T	C	6: 120,412,402	V930A	probably damaging	Het
Kdm5b	C	A	1: 134,593,315		probably null	Het
Lexm	T	A	4: 106,610,527		probably null	Het
Lilra5	T	C	7: 4,238,714	F171L	possibly damaging	Het
Map1b	A	G	13: 99,431,054	S1720P	unknown	Het
Mcpt1	A	T	14: 56,019,560	Q185L	probably damaging	Het
Mmp20	T	A	9: 7,644,026	D238E	possibly damaging	Het
Mov10l1	A	T	15: 89,020,269	I784F	possibly damaging	Het
Mroh2b	C	T	15: 4,904,270	P101S	probably damaging	Het
Myh3	G	T	11: 67,096,939	A1413S	probably benign	Het
Nat6	A	T	9: 107,583,539	Y211F	probably damaging	Het
Npdc1	G	A	2: 25,408,945	D284N	probably damaging	Het
Olfr1009	A	G	2: 85,721,449	I15V	probably benign	Het
Olfr1054	A	T	2: 86,333,227	M43K	probably benign	Het
Olfr1056	G	A	2: 86,355,750	L211F	probably benign	Het
Olfr1196	A	G	2: 88,701,200	I43T	probably damaging	Het
Olfr330	A	C	11: 58,529,482	M168R	probably damaging	Het
Olfr533	A	G	7: 140,467,076	R292G	probably damaging	Het
Palld	T	A	8: 61,687,381	T531S	probably benign	Het
Parp4	A	G	14: 56,585,738	E105G	probably benign	Het
Phf11a	A	T	14: 59,287,579	S59T	probably damaging	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Rad50	A	T	11: 53,650,653	I1252N	probably damaging	Het
Ramp3	A	G	11: 6,674,761		probably null	Het
Rrbp1	G	A	2: 143,988,417	T610I	possibly damaging	Het
Slc4a10	A	G	2: 62,268,187	Y555C	probably damaging	Het
Slc5a2	A	G	7: 128,267,505		probably null	Het
Smoc1	T	A	12: 81,179,548	D371E	probably damaging	Het
Stmn1	T	A	4: 134,470,184		probably benign	Het
Sulf1	C	T	1: 12,842,686	L715F	probably benign	Het
Surf1	T	C	2: 26,914,243	T180A	possibly damaging	Het
Syne2	A	G	12: 75,979,819	I3474V	probably damaging	Het
Tchh	A	T	3: 93,445,148	R632W	unknown	Het
Tchh	A	T	3: 93,447,588	D1445V	unknown	Het
Tctn1	A	T	5: 122,245,505	M505K	probably benign	Het
Tdrkh	T	A	3: 94,425,590	I150N	probably damaging	Het
Tespa1	C	T	10: 130,362,159	T350I	probably benign	Het
Thbs1	A	G	2: 118,115,018	Y326C	possibly damaging	Het
Tmem208	C	T	8: 105,328,664	S119F	probably damaging	Het
Tmprss6	G	C	15: 78,445,388	A91G	probably damaging	Het
Trp53bp2	C	T	1: 182,431,582	R67W	probably damaging	Het
Ttn	A	G	2: 76,711,197	I25488T	possibly damaging	Het
Txnl4a	A	G	18: 80,222,253	E111G	probably damaging	Het
Unc13b	T	G	4: 43,237,137	I3402M	probably damaging	Het
Vmn1r188	A	C	13: 22,088,121	I82L	probably benign	Het
Zfp65	A	G	13: 67,708,875	V95A	probably benign	Het
Zfp985	T	A	4: 147,584,155	S493R	probably damaging	Het

Other mutations in Itpr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Itpr1	APN	6	108471120	missense	probably damaging	0.98
IGL01073:Itpr1	APN	6	108413820	missense	probably benign	0.00
IGL01105:Itpr1	APN	6	108381333	missense	probably benign	0.00
IGL01296:Itpr1	APN	6	108399361	missense	probably damaging	1.00
IGL01325:Itpr1	APN	6	108381208	missense	probably benign	0.01
IGL01418:Itpr1	APN	6	108339624	critical splice donor site	probably null
IGL01464:Itpr1	APN	6	108386727	missense	possibly damaging	0.95
IGL01467:Itpr1	APN	6	108488496	missense	probably damaging	0.96
IGL01645:Itpr1	APN	6	108473599	missense	possibly damaging	0.91
IGL01672:Itpr1	APN	6	108381032	nonsense	probably null
IGL01969:Itpr1	APN	6	108377691	missense	probably damaging	1.00
IGL02164:Itpr1	APN	6	108389483	missense	probably benign	0.08
IGL02206:Itpr1	APN	6	108549820	missense	probably damaging	1.00
IGL02232:Itpr1	APN	6	108417923	missense	probably damaging	1.00
IGL02297:Itpr1	APN	6	108339517	missense	possibly damaging	0.84
IGL02434:Itpr1	APN	6	108489922	splice site	probably null
IGL02568:Itpr1	APN	6	108339554	missense	possibly damaging	0.82
IGL02992:Itpr1	APN	6	108381315	missense	probably damaging	1.00
IGL03109:Itpr1	APN	6	108417981	missense	probably damaging	1.00
IGL03130:Itpr1	APN	6	108523401	missense	probably benign	0.00
IGL03333:Itpr1	APN	6	108380910	unclassified	probably benign
aboriginal	UTSW	6	108515947	missense	probably benign
approximation	UTSW	6	108394841	missense	probably benign
estimate	UTSW	6	108389553	missense	probably null	1.00
icarus	UTSW	6	108410900	missense	probably damaging	1.00
marsupialized	UTSW	6	108394073	splice site	probably null
primordial	UTSW	6	108518755	missense	probably benign	0.06
roo	UTSW	6	108410867	missense	probably benign	0.00
wallaby	UTSW	6	108389387	missense	probably damaging	1.00
P0005:Itpr1	UTSW	6	108381257	missense	probably damaging	1.00
PIT4366001:Itpr1	UTSW	6	108493757	nonsense	probably null
R0019:Itpr1	UTSW	6	108354626	missense	probably damaging	1.00
R0128:Itpr1	UTSW	6	108471209	splice site	probably benign
R0129:Itpr1	UTSW	6	108349676	missense	probably damaging	1.00
R0135:Itpr1	UTSW	6	108488482	splice site	probably benign
R0244:Itpr1	UTSW	6	108473589	missense	probably benign	0.00
R0391:Itpr1	UTSW	6	108378167	missense	probably benign	0.22
R0543:Itpr1	UTSW	6	108515748	splice site	probably benign
R0647:Itpr1	UTSW	6	108383698	missense	probably damaging	1.00
R0766:Itpr1	UTSW	6	108410900	missense	probably damaging	1.00
R0971:Itpr1	UTSW	6	108349629	missense	possibly damaging	0.70
R1083:Itpr1	UTSW	6	108510696	missense	possibly damaging	0.92
R1277:Itpr1	UTSW	6	108339621	missense	probably benign	0.22
R1403:Itpr1	UTSW	6	108389553	missense	probably null	1.00
R1403:Itpr1	UTSW	6	108389553	missense	probably null	1.00
R1404:Itpr1	UTSW	6	108386648	missense	probably benign	0.04
R1404:Itpr1	UTSW	6	108386648	missense	probably benign	0.04
R1605:Itpr1	UTSW	6	108349659	missense	possibly damaging	0.77
R1661:Itpr1	UTSW	6	108482897	missense	probably benign	0.38
R1852:Itpr1	UTSW	6	108386706	missense	probably damaging	1.00
R1929:Itpr1	UTSW	6	108493755	missense	probably damaging	1.00
R2012:Itpr1	UTSW	6	108440536	missense	probably benign	0.02
R2027:Itpr1	UTSW	6	108386853	missense	possibly damaging	0.80
R2111:Itpr1	UTSW	6	108378309	unclassified	probably benign
R2166:Itpr1	UTSW	6	108388225	missense	probably damaging	1.00
R2272:Itpr1	UTSW	6	108493755	missense	probably damaging	1.00
R2484:Itpr1	UTSW	6	108369110	missense	probably damaging	1.00
R3115:Itpr1	UTSW	6	108406109	missense	possibly damaging	0.55
R3751:Itpr1	UTSW	6	108349680	missense	probably damaging	1.00
R3798:Itpr1	UTSW	6	108381270	missense	probably damaging	1.00
R3930:Itpr1	UTSW	6	108394841	missense	probably benign
R4081:Itpr1	UTSW	6	108391835	missense	probably damaging	1.00
R4119:Itpr1	UTSW	6	108394355	missense	probably benign
R4406:Itpr1	UTSW	6	108354663	missense	probably damaging	1.00
R4506:Itpr1	UTSW	6	108432686	missense	probably damaging	1.00
R4616:Itpr1	UTSW	6	108481223	missense	probably damaging	1.00
R4655:Itpr1	UTSW	6	108481293	missense	probably damaging	1.00
R4661:Itpr1	UTSW	6	108410931	critical splice donor site	probably null
R4760:Itpr1	UTSW	6	108349632	missense	probably benign	0.29
R4857:Itpr1	UTSW	6	108410867	missense	probably benign	0.00
R4876:Itpr1	UTSW	6	108482906	missense	probably damaging	0.97
R4939:Itpr1	UTSW	6	108440558	nonsense	probably null
R5076:Itpr1	UTSW	6	108405529	splice site	probably null
R5088:Itpr1	UTSW	6	108389387	missense	probably damaging	1.00
R5248:Itpr1	UTSW	6	108542062	missense	probably damaging	1.00
R5290:Itpr1	UTSW	6	108406145	missense	possibly damaging	0.95
R5308:Itpr1	UTSW	6	108356511	missense	probably damaging	1.00
R5339:Itpr1	UTSW	6	108393961	missense	probably damaging	1.00
R5368:Itpr1	UTSW	6	108387498	missense	probably damaging	1.00
R5369:Itpr1	UTSW	6	108519424	missense	probably damaging	0.99
R5419:Itpr1	UTSW	6	108493794	missense	possibly damaging	0.95
R5615:Itpr1	UTSW	6	108488600	missense	possibly damaging	0.71
R5779:Itpr1	UTSW	6	108352143	missense	probably damaging	1.00
R5781:Itpr1	UTSW	6	108510738	missense	probably benign	0.23
R5869:Itpr1	UTSW	6	108473529	missense	probably benign	0.30
R5903:Itpr1	UTSW	6	108489797	intron	probably benign
R5929:Itpr1	UTSW	6	108423336	missense	probably benign
R5956:Itpr1	UTSW	6	108506027	missense	probably benign	0.25
R6160:Itpr1	UTSW	6	108518755	missense	probably benign	0.06
R6163:Itpr1	UTSW	6	108388284	missense	probably damaging	1.00
R6169:Itpr1	UTSW	6	108369116	missense	probably damaging	1.00
R6237:Itpr1	UTSW	6	108378203	missense	possibly damaging	0.53
R6398:Itpr1	UTSW	6	108505903	missense	probably damaging	0.96
R6455:Itpr1	UTSW	6	108417972	missense	probably damaging	1.00
R6522:Itpr1	UTSW	6	108388276	missense	probably damaging	1.00
R6524:Itpr1	UTSW	6	108363683	missense	probably damaging	1.00
R6650:Itpr1	UTSW	6	108394073	splice site	probably null
R6806:Itpr1	UTSW	6	108515947	missense	probably benign
R6838:Itpr1	UTSW	6	108471191	missense	possibly damaging	0.87
R6841:Itpr1	UTSW	6	108388192	missense	probably damaging	1.00
R6896:Itpr1	UTSW	6	108481394	missense	probably damaging	1.00
R7014:Itpr1	UTSW	6	108431498	critical splice donor site	probably null
R7076:Itpr1	UTSW	6	108388296	missense	probably benign
R7116:Itpr1	UTSW	6	108481268	missense	probably damaging	0.99
R7152:Itpr1	UTSW	6	108394407	critical splice donor site	probably null
R7161:Itpr1	UTSW	6	108386640	missense	probably damaging	1.00
R7166:Itpr1	UTSW	6	108378190	missense	probably benign	0.06
R7241:Itpr1	UTSW	6	108517620	critical splice donor site	probably null
R7301:Itpr1	UTSW	6	108542024	missense	possibly damaging	0.86
R7330:Itpr1	UTSW	6	108438331	missense	probably benign	0.28
R7449:Itpr1	UTSW	6	108389384	missense	probably damaging	0.98
R7472:Itpr1	UTSW	6	108403396	missense	probably benign	0.05
R7502:Itpr1	UTSW	6	108383678	missense	probably benign	0.00
R7779:Itpr1	UTSW	6	108523348	missense	possibly damaging	0.75
R7828:Itpr1	UTSW	6	108482931	missense	probably damaging	1.00
R7854:Itpr1	UTSW	6	108387369	missense	probably damaging	1.00
R7974:Itpr1	UTSW	6	108523405	missense	possibly damaging	0.86
R7998:Itpr1	UTSW	6	108417948	missense	possibly damaging	0.88
R8039:Itpr1	UTSW	6	108386628	missense	probably damaging	1.00
R8136:Itpr1	UTSW	6	108438360	missense	probably benign	0.18
R8200:Itpr1	UTSW	6	108394865	missense	probably benign	0.00
R8242:Itpr1	UTSW	6	108386697	missense	probably benign	0.44
R8322:Itpr1	UTSW	6	108388229	missense	probably benign	0.05
R8377:Itpr1	UTSW	6	108510738	missense	probably benign	0.00
R8412:Itpr1	UTSW	6	108363620	missense	probably benign	0.07
R8443:Itpr1	UTSW	6	108519348	missense	probably damaging	0.99
R8669:Itpr1	UTSW	6	108393967	missense	probably damaging	0.99
R8697:Itpr1	UTSW	6	108523366	missense	probably damaging	1.00
R8744:Itpr1	UTSW	6	108377802	missense	possibly damaging	0.79
R8870:Itpr1	UTSW	6	108388211	missense	probably damaging	1.00
R8921:Itpr1	UTSW	6	108378198	missense	possibly damaging	0.87
R8961:Itpr1	UTSW	6	108493705	missense	possibly damaging	0.86
R9095:Itpr1	UTSW	6	108387391	missense	probably benign	0.02
R9205:Itpr1	UTSW	6	108489849	missense	probably damaging	0.99
R9282:Itpr1	UTSW	6	108394023	missense	probably damaging	1.00
R9323:Itpr1	UTSW	6	108352018	missense	probably damaging	1.00
R9376:Itpr1	UTSW	6	108349677	missense	probably damaging	0.99
R9392:Itpr1	UTSW	6	108413876	missense	probably benign
R9428:Itpr1	UTSW	6	108401347	missense	possibly damaging	0.84
R9621:Itpr1	UTSW	6	108416909	missense	probably damaging	1.00
R9632:Itpr1	UTSW	6	108405520	missense	possibly damaging	0.50
R9646:Itpr1	UTSW	6	108394884	missense	probably damaging	1.00
R9695:Itpr1	UTSW	6	108401350	missense	probably damaging	1.00
R9710:Itpr1	UTSW	6	108405520	missense	possibly damaging	0.50
R9721:Itpr1	UTSW	6	108406102	missense	probably damaging	0.96
R9780:Itpr1	UTSW	6	108510834	missense	probably benign	0.03
Z1176:Itpr1	UTSW	6	108499149	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGGCAGTAACGTGATGAGGTC -3'
(R):5'- ACGAGTTCTGAGATGGCAGAC -3'

Sequencing Primer
(F):5'- CAGTAACGTGATGAGGTCTATCC -3'
(R):5'- GTTCTGAGATGGCAGACTAGAC -3'

Posted On

2016-03-01