Incidental Mutation 'R4836:Itpr1'
ID 373235
Institutional Source Beutler Lab
Gene Symbol Itpr1
Ensembl Gene ENSMUSG00000030102
Gene Name inositol 1,4,5-trisphosphate receptor 1
Synonyms opt, IP3R1, P400, wblo, Ip3r, Pcp-1, Itpr-1, InsP3R type I, Pcp1
MMRRC Submission 042451-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.736) question?
Stock # R4836 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 108190057-108528070 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 108366498 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 142 (I142F)
Ref Sequence ENSEMBL: ENSMUSP00000148284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203615] [ENSMUST00000212125]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000032192
AA Change: I974F

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: I974F

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1758 1787 N/A INTRINSIC
Pfam:RIH_assoc 1959 2069 1.2e-33 PFAM
transmembrane domain 2274 2296 N/A INTRINSIC
Pfam:Ion_trans 2311 2600 9e-22 PFAM
coiled coil region 2683 2732 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203615
AA Change: I974F

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: I974F

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1757 1786 N/A INTRINSIC
Pfam:RIH_assoc 1958 2068 1.2e-33 PFAM
transmembrane domain 2273 2295 N/A INTRINSIC
Pfam:Ion_trans 2310 2599 9e-22 PFAM
coiled coil region 2682 2731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203995
Predicted Effect probably damaging
Transcript: ENSMUST00000212125
AA Change: I142F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.5024 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]
Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox1 A T 11: 116,066,152 (GRCm39) S453T probably benign Het
Ahnak2 A T 12: 112,740,550 (GRCm39) V368D probably damaging Het
Ankrd53 A T 6: 83,745,134 (GRCm39) Y448F probably damaging Het
Arhgef15 A T 11: 68,840,751 (GRCm39) probably benign Het
Atg2b T C 12: 105,613,073 (GRCm39) N1166S probably benign Het
Atl3 C T 19: 7,486,910 (GRCm39) R77* probably null Het
Bend6 T C 1: 33,922,654 (GRCm39) probably benign Het
Ccnt1 C A 15: 98,465,444 (GRCm39) R25L probably damaging Het
Cct4 A G 11: 22,952,898 (GRCm39) T525A probably benign Het
Cep350 T C 1: 155,804,579 (GRCm39) I835V probably damaging Het
Cimap2 T A 4: 106,467,724 (GRCm39) probably null Het
Clcn1 G T 6: 42,286,898 (GRCm39) V652L probably damaging Het
Cntln T A 4: 84,967,957 (GRCm39) Y725* probably null Het
Cog5 T C 12: 31,969,732 (GRCm39) F21L probably benign Het
D6Ertd527e GGCAGCAGCAGCA GGCAGCAGCAGCAGCA 6: 87,088,406 (GRCm39) probably benign Het
Dnm2 A T 9: 21,402,626 (GRCm39) probably benign Het
Dnmt1 C T 9: 20,819,854 (GRCm39) V1430I probably damaging Het
Dpep1 A G 8: 123,927,106 (GRCm39) D285G probably damaging Het
Eef2kmt C T 16: 5,066,867 (GRCm39) V129M probably damaging Het
Epha3 A T 16: 63,403,920 (GRCm39) M726K probably damaging Het
Fat3 A G 9: 16,289,019 (GRCm39) L168P probably damaging Het
Frem3 T A 8: 81,390,026 (GRCm39) F1759Y probably damaging Het
Fubp3 T A 2: 31,498,153 (GRCm39) S56R possibly damaging Het
Gm1965 T C 6: 89,122,392 (GRCm39) noncoding transcript Het
Gm5592 C T 7: 40,864,958 (GRCm39) probably benign Het
H1f9 T A 11: 94,858,843 (GRCm39) L46* probably null Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,265,453 (GRCm39) 913 probably null Het
Isl1 A G 13: 116,439,619 (GRCm39) M243T probably benign Het
Jak1 T C 4: 101,012,263 (GRCm39) T1069A probably damaging Het
Jmjd1c T C 10: 67,069,225 (GRCm39) V1848A probably benign Het
Kdm5a T C 6: 120,389,363 (GRCm39) V930A probably damaging Het
Kdm5b C A 1: 134,521,053 (GRCm39) probably null Het
Lilra5 T C 7: 4,241,713 (GRCm39) F171L possibly damaging Het
Map1b A G 13: 99,567,562 (GRCm39) S1720P unknown Het
Mcpt1 A T 14: 56,257,017 (GRCm39) Q185L probably damaging Het
Mmp20 T A 9: 7,644,027 (GRCm39) D238E possibly damaging Het
Mov10l1 A T 15: 88,904,472 (GRCm39) I784F possibly damaging Het
Mroh2b C T 15: 4,933,752 (GRCm39) P101S probably damaging Het
Myh3 G T 11: 66,987,765 (GRCm39) A1413S probably benign Het
Naa80 A T 9: 107,460,738 (GRCm39) Y211F probably damaging Het
Npdc1 G A 2: 25,298,957 (GRCm39) D284N probably damaging Het
Or12j4 A G 7: 140,046,989 (GRCm39) R292G probably damaging Het
Or2t48 A C 11: 58,420,308 (GRCm39) M168R probably damaging Het
Or4a66 A G 2: 88,531,544 (GRCm39) I43T probably damaging Het
Or5g9 A G 2: 85,551,793 (GRCm39) I15V probably benign Het
Or8k22 A T 2: 86,163,571 (GRCm39) M43K probably benign Het
Or8k23 G A 2: 86,186,094 (GRCm39) L211F probably benign Het
Palld T A 8: 62,140,415 (GRCm39) T531S probably benign Het
Parp4 A G 14: 56,823,195 (GRCm39) E105G probably benign Het
Phf11a A T 14: 59,525,028 (GRCm39) S59T probably damaging Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Rad50 A T 11: 53,541,480 (GRCm39) I1252N probably damaging Het
Ramp3 A G 11: 6,624,761 (GRCm39) probably null Het
Rrbp1 G A 2: 143,830,337 (GRCm39) T610I possibly damaging Het
Scart2 T C 7: 139,879,021 (GRCm39) I1051T probably benign Het
Semp2l2a C T 8: 13,888,007 (GRCm39) S28N probably benign Het
Slc4a10 A G 2: 62,098,531 (GRCm39) Y555C probably damaging Het
Slc5a2 A G 7: 127,866,677 (GRCm39) probably null Het
Smoc1 T A 12: 81,226,322 (GRCm39) D371E probably damaging Het
Stmn1 T A 4: 134,197,495 (GRCm39) probably benign Het
Sulf1 C T 1: 12,912,910 (GRCm39) L715F probably benign Het
Surf1 T C 2: 26,804,255 (GRCm39) T180A possibly damaging Het
Syne2 A G 12: 76,026,593 (GRCm39) I3474V probably damaging Het
Tchh A T 3: 93,352,455 (GRCm39) R632W unknown Het
Tchh A T 3: 93,354,895 (GRCm39) D1445V unknown Het
Tctn1 A T 5: 122,383,568 (GRCm39) M505K probably benign Het
Tdrkh T A 3: 94,332,897 (GRCm39) I150N probably damaging Het
Tespa1 C T 10: 130,198,028 (GRCm39) T350I probably benign Het
Thbs1 A G 2: 117,945,499 (GRCm39) Y326C possibly damaging Het
Tmem208 C T 8: 106,055,296 (GRCm39) S119F probably damaging Het
Tmprss6 G C 15: 78,329,588 (GRCm39) A91G probably damaging Het
Trp53bp2 C T 1: 182,259,147 (GRCm39) R67W probably damaging Het
Ttn A G 2: 76,541,541 (GRCm39) I25488T possibly damaging Het
Txnl4a A G 18: 80,265,468 (GRCm39) E111G probably damaging Het
Unc13b T G 4: 43,237,137 (GRCm39) I3402M probably damaging Het
Vmn1r188 A C 13: 22,272,291 (GRCm39) I82L probably benign Het
Zfp65 A G 13: 67,856,994 (GRCm39) V95A probably benign Het
Zfp985 T A 4: 147,668,612 (GRCm39) S493R probably damaging Het
Other mutations in Itpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Itpr1 APN 6 108,448,081 (GRCm39) missense probably damaging 0.98
IGL01073:Itpr1 APN 6 108,390,781 (GRCm39) missense probably benign 0.00
IGL01105:Itpr1 APN 6 108,358,294 (GRCm39) missense probably benign 0.00
IGL01296:Itpr1 APN 6 108,376,322 (GRCm39) missense probably damaging 1.00
IGL01325:Itpr1 APN 6 108,358,169 (GRCm39) missense probably benign 0.01
IGL01418:Itpr1 APN 6 108,316,585 (GRCm39) critical splice donor site probably null
IGL01464:Itpr1 APN 6 108,363,688 (GRCm39) missense possibly damaging 0.95
IGL01467:Itpr1 APN 6 108,465,457 (GRCm39) missense probably damaging 0.96
IGL01645:Itpr1 APN 6 108,450,560 (GRCm39) missense possibly damaging 0.91
IGL01672:Itpr1 APN 6 108,357,993 (GRCm39) nonsense probably null
IGL01969:Itpr1 APN 6 108,354,652 (GRCm39) missense probably damaging 1.00
IGL02164:Itpr1 APN 6 108,366,444 (GRCm39) missense probably benign 0.08
IGL02206:Itpr1 APN 6 108,526,781 (GRCm39) missense probably damaging 1.00
IGL02232:Itpr1 APN 6 108,394,884 (GRCm39) missense probably damaging 1.00
IGL02297:Itpr1 APN 6 108,316,478 (GRCm39) missense possibly damaging 0.84
IGL02434:Itpr1 APN 6 108,466,883 (GRCm39) splice site probably null
IGL02568:Itpr1 APN 6 108,316,515 (GRCm39) missense possibly damaging 0.82
IGL02992:Itpr1 APN 6 108,358,276 (GRCm39) missense probably damaging 1.00
IGL03109:Itpr1 APN 6 108,394,942 (GRCm39) missense probably damaging 1.00
IGL03130:Itpr1 APN 6 108,500,362 (GRCm39) missense probably benign 0.00
IGL03333:Itpr1 APN 6 108,357,871 (GRCm39) unclassified probably benign
aboriginal UTSW 6 108,492,908 (GRCm39) missense probably benign
approximation UTSW 6 108,371,802 (GRCm39) missense probably benign
estimate UTSW 6 108,366,514 (GRCm39) missense probably null 1.00
icarus UTSW 6 108,387,861 (GRCm39) missense probably damaging 1.00
marsupialized UTSW 6 108,371,034 (GRCm39) splice site probably null
primordial UTSW 6 108,495,716 (GRCm39) missense probably benign 0.06
roo UTSW 6 108,387,828 (GRCm39) missense probably benign 0.00
wallaby UTSW 6 108,366,348 (GRCm39) missense probably damaging 1.00
P0005:Itpr1 UTSW 6 108,358,218 (GRCm39) missense probably damaging 1.00
PIT4366001:Itpr1 UTSW 6 108,470,718 (GRCm39) nonsense probably null
R0019:Itpr1 UTSW 6 108,331,587 (GRCm39) missense probably damaging 1.00
R0128:Itpr1 UTSW 6 108,448,170 (GRCm39) splice site probably benign
R0129:Itpr1 UTSW 6 108,326,637 (GRCm39) missense probably damaging 1.00
R0135:Itpr1 UTSW 6 108,465,443 (GRCm39) splice site probably benign
R0244:Itpr1 UTSW 6 108,450,550 (GRCm39) missense probably benign 0.00
R0391:Itpr1 UTSW 6 108,355,128 (GRCm39) missense probably benign 0.22
R0543:Itpr1 UTSW 6 108,492,709 (GRCm39) splice site probably benign
R0647:Itpr1 UTSW 6 108,360,659 (GRCm39) missense probably damaging 1.00
R0766:Itpr1 UTSW 6 108,387,861 (GRCm39) missense probably damaging 1.00
R0971:Itpr1 UTSW 6 108,326,590 (GRCm39) missense possibly damaging 0.70
R1083:Itpr1 UTSW 6 108,487,657 (GRCm39) missense possibly damaging 0.92
R1277:Itpr1 UTSW 6 108,316,582 (GRCm39) missense probably benign 0.22
R1403:Itpr1 UTSW 6 108,366,514 (GRCm39) missense probably null 1.00
R1403:Itpr1 UTSW 6 108,366,514 (GRCm39) missense probably null 1.00
R1404:Itpr1 UTSW 6 108,363,609 (GRCm39) missense probably benign 0.04
R1404:Itpr1 UTSW 6 108,363,609 (GRCm39) missense probably benign 0.04
R1605:Itpr1 UTSW 6 108,326,620 (GRCm39) missense possibly damaging 0.77
R1661:Itpr1 UTSW 6 108,459,858 (GRCm39) missense probably benign 0.38
R1852:Itpr1 UTSW 6 108,363,667 (GRCm39) missense probably damaging 1.00
R1929:Itpr1 UTSW 6 108,470,716 (GRCm39) missense probably damaging 1.00
R2012:Itpr1 UTSW 6 108,417,497 (GRCm39) missense probably benign 0.02
R2027:Itpr1 UTSW 6 108,363,814 (GRCm39) missense possibly damaging 0.80
R2111:Itpr1 UTSW 6 108,355,270 (GRCm39) unclassified probably benign
R2166:Itpr1 UTSW 6 108,365,186 (GRCm39) missense probably damaging 1.00
R2272:Itpr1 UTSW 6 108,470,716 (GRCm39) missense probably damaging 1.00
R2484:Itpr1 UTSW 6 108,346,071 (GRCm39) missense probably damaging 1.00
R3115:Itpr1 UTSW 6 108,383,070 (GRCm39) missense possibly damaging 0.55
R3751:Itpr1 UTSW 6 108,326,641 (GRCm39) missense probably damaging 1.00
R3798:Itpr1 UTSW 6 108,358,231 (GRCm39) missense probably damaging 1.00
R3930:Itpr1 UTSW 6 108,371,802 (GRCm39) missense probably benign
R4081:Itpr1 UTSW 6 108,368,796 (GRCm39) missense probably damaging 1.00
R4119:Itpr1 UTSW 6 108,371,316 (GRCm39) missense probably benign
R4406:Itpr1 UTSW 6 108,331,624 (GRCm39) missense probably damaging 1.00
R4506:Itpr1 UTSW 6 108,409,647 (GRCm39) missense probably damaging 1.00
R4616:Itpr1 UTSW 6 108,458,184 (GRCm39) missense probably damaging 1.00
R4655:Itpr1 UTSW 6 108,458,254 (GRCm39) missense probably damaging 1.00
R4661:Itpr1 UTSW 6 108,387,892 (GRCm39) critical splice donor site probably null
R4760:Itpr1 UTSW 6 108,326,593 (GRCm39) missense probably benign 0.29
R4857:Itpr1 UTSW 6 108,387,828 (GRCm39) missense probably benign 0.00
R4876:Itpr1 UTSW 6 108,459,867 (GRCm39) missense probably damaging 0.97
R4939:Itpr1 UTSW 6 108,417,519 (GRCm39) nonsense probably null
R5076:Itpr1 UTSW 6 108,382,490 (GRCm39) splice site probably null
R5088:Itpr1 UTSW 6 108,366,348 (GRCm39) missense probably damaging 1.00
R5248:Itpr1 UTSW 6 108,519,023 (GRCm39) missense probably damaging 1.00
R5290:Itpr1 UTSW 6 108,383,106 (GRCm39) missense possibly damaging 0.95
R5308:Itpr1 UTSW 6 108,333,472 (GRCm39) missense probably damaging 1.00
R5339:Itpr1 UTSW 6 108,370,922 (GRCm39) missense probably damaging 1.00
R5368:Itpr1 UTSW 6 108,364,459 (GRCm39) missense probably damaging 1.00
R5369:Itpr1 UTSW 6 108,496,385 (GRCm39) missense probably damaging 0.99
R5419:Itpr1 UTSW 6 108,470,755 (GRCm39) missense possibly damaging 0.95
R5615:Itpr1 UTSW 6 108,465,561 (GRCm39) missense possibly damaging 0.71
R5779:Itpr1 UTSW 6 108,329,104 (GRCm39) missense probably damaging 1.00
R5781:Itpr1 UTSW 6 108,487,699 (GRCm39) missense probably benign 0.23
R5869:Itpr1 UTSW 6 108,450,490 (GRCm39) missense probably benign 0.30
R5903:Itpr1 UTSW 6 108,466,758 (GRCm39) intron probably benign
R5929:Itpr1 UTSW 6 108,400,297 (GRCm39) missense probably benign
R5956:Itpr1 UTSW 6 108,482,988 (GRCm39) missense probably benign 0.25
R6160:Itpr1 UTSW 6 108,495,716 (GRCm39) missense probably benign 0.06
R6163:Itpr1 UTSW 6 108,365,245 (GRCm39) missense probably damaging 1.00
R6169:Itpr1 UTSW 6 108,346,077 (GRCm39) missense probably damaging 1.00
R6237:Itpr1 UTSW 6 108,355,164 (GRCm39) missense possibly damaging 0.53
R6398:Itpr1 UTSW 6 108,482,864 (GRCm39) missense probably damaging 0.96
R6455:Itpr1 UTSW 6 108,394,933 (GRCm39) missense probably damaging 1.00
R6522:Itpr1 UTSW 6 108,365,237 (GRCm39) missense probably damaging 1.00
R6524:Itpr1 UTSW 6 108,340,644 (GRCm39) missense probably damaging 1.00
R6650:Itpr1 UTSW 6 108,371,034 (GRCm39) splice site probably null
R6806:Itpr1 UTSW 6 108,492,908 (GRCm39) missense probably benign
R6838:Itpr1 UTSW 6 108,448,152 (GRCm39) missense possibly damaging 0.87
R6841:Itpr1 UTSW 6 108,365,153 (GRCm39) missense probably damaging 1.00
R6896:Itpr1 UTSW 6 108,458,355 (GRCm39) missense probably damaging 1.00
R7014:Itpr1 UTSW 6 108,408,459 (GRCm39) critical splice donor site probably null
R7076:Itpr1 UTSW 6 108,365,257 (GRCm39) missense probably benign
R7116:Itpr1 UTSW 6 108,458,229 (GRCm39) missense probably damaging 0.99
R7152:Itpr1 UTSW 6 108,371,368 (GRCm39) critical splice donor site probably null
R7161:Itpr1 UTSW 6 108,363,601 (GRCm39) missense probably damaging 1.00
R7166:Itpr1 UTSW 6 108,355,151 (GRCm39) missense probably benign 0.06
R7241:Itpr1 UTSW 6 108,494,581 (GRCm39) critical splice donor site probably null
R7301:Itpr1 UTSW 6 108,518,985 (GRCm39) missense possibly damaging 0.86
R7330:Itpr1 UTSW 6 108,415,292 (GRCm39) missense probably benign 0.28
R7449:Itpr1 UTSW 6 108,366,345 (GRCm39) missense probably damaging 0.98
R7472:Itpr1 UTSW 6 108,380,357 (GRCm39) missense probably benign 0.05
R7502:Itpr1 UTSW 6 108,360,639 (GRCm39) missense probably benign 0.00
R7779:Itpr1 UTSW 6 108,500,309 (GRCm39) missense possibly damaging 0.75
R7828:Itpr1 UTSW 6 108,459,892 (GRCm39) missense probably damaging 1.00
R7854:Itpr1 UTSW 6 108,364,330 (GRCm39) missense probably damaging 1.00
R7974:Itpr1 UTSW 6 108,500,366 (GRCm39) missense possibly damaging 0.86
R7998:Itpr1 UTSW 6 108,394,909 (GRCm39) missense possibly damaging 0.88
R8039:Itpr1 UTSW 6 108,363,589 (GRCm39) missense probably damaging 1.00
R8136:Itpr1 UTSW 6 108,415,321 (GRCm39) missense probably benign 0.18
R8200:Itpr1 UTSW 6 108,371,826 (GRCm39) missense probably benign 0.00
R8242:Itpr1 UTSW 6 108,363,658 (GRCm39) missense probably benign 0.44
R8322:Itpr1 UTSW 6 108,365,190 (GRCm39) missense probably benign 0.05
R8377:Itpr1 UTSW 6 108,487,699 (GRCm39) missense probably benign 0.00
R8412:Itpr1 UTSW 6 108,340,581 (GRCm39) missense probably benign 0.07
R8443:Itpr1 UTSW 6 108,496,309 (GRCm39) missense probably damaging 0.99
R8669:Itpr1 UTSW 6 108,370,928 (GRCm39) missense probably damaging 0.99
R8697:Itpr1 UTSW 6 108,500,327 (GRCm39) missense probably damaging 1.00
R8744:Itpr1 UTSW 6 108,354,763 (GRCm39) missense possibly damaging 0.79
R8870:Itpr1 UTSW 6 108,365,172 (GRCm39) missense probably damaging 1.00
R8921:Itpr1 UTSW 6 108,355,159 (GRCm39) missense possibly damaging 0.87
R8961:Itpr1 UTSW 6 108,470,666 (GRCm39) missense possibly damaging 0.86
R9095:Itpr1 UTSW 6 108,364,352 (GRCm39) missense probably benign 0.02
R9205:Itpr1 UTSW 6 108,466,810 (GRCm39) missense probably damaging 0.99
R9282:Itpr1 UTSW 6 108,370,984 (GRCm39) missense probably damaging 1.00
R9323:Itpr1 UTSW 6 108,328,979 (GRCm39) missense probably damaging 1.00
R9376:Itpr1 UTSW 6 108,326,638 (GRCm39) missense probably damaging 0.99
R9392:Itpr1 UTSW 6 108,390,837 (GRCm39) missense probably benign
R9428:Itpr1 UTSW 6 108,378,308 (GRCm39) missense possibly damaging 0.84
R9621:Itpr1 UTSW 6 108,393,870 (GRCm39) missense probably damaging 1.00
R9632:Itpr1 UTSW 6 108,382,481 (GRCm39) missense possibly damaging 0.50
R9646:Itpr1 UTSW 6 108,371,845 (GRCm39) missense probably damaging 1.00
R9695:Itpr1 UTSW 6 108,378,311 (GRCm39) missense probably damaging 1.00
R9710:Itpr1 UTSW 6 108,382,481 (GRCm39) missense possibly damaging 0.50
R9721:Itpr1 UTSW 6 108,383,063 (GRCm39) missense probably damaging 0.96
R9780:Itpr1 UTSW 6 108,487,795 (GRCm39) missense probably benign 0.03
Z1176:Itpr1 UTSW 6 108,476,110 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGCAGTAACGTGATGAGGTC -3'
(R):5'- ACGAGTTCTGAGATGGCAGAC -3'

Sequencing Primer
(F):5'- CAGTAACGTGATGAGGTCTATCC -3'
(R):5'- GTTCTGAGATGGCAGACTAGAC -3'
Posted On 2016-03-01