Incidental Mutation 'R4836:Syne2'
ID 373261
Institutional Source Beutler Lab
Gene Symbol Syne2
Ensembl Gene ENSMUSG00000063450
Gene Name spectrin repeat containing, nuclear envelope 2
Synonyms Nesp2g, diminished cone electroretinogram, Cpfl8, dice, 6820443O06Rik, nesprin-2, syne-2, D12Ertd777e
MMRRC Submission 042451-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.313) question?
Stock # R4836 (G1)
Quality Score 224
Status Validated
Chromosome 12
Chromosomal Location 75865092-76157702 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 76026593 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 3474 (I3474V)
Ref Sequence ENSEMBL: ENSMUSP00000047697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044217] [ENSMUST00000143031]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000044217
AA Change: I3474V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047697
Gene: ENSMUSG00000063450
AA Change: I3474V

DomainStartEndE-ValueType
CH 33 134 7.97e-19 SMART
low complexity region 151 175 N/A INTRINSIC
CH 185 283 1.34e-20 SMART
low complexity region 494 505 N/A INTRINSIC
coiled coil region 541 572 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
coiled coil region 844 869 N/A INTRINSIC
coiled coil region 936 969 N/A INTRINSIC
coiled coil region 1006 1032 N/A INTRINSIC
SPEC 1427 1525 4.96e0 SMART
SPEC 1528 1632 2.48e-1 SMART
coiled coil region 1660 1699 N/A INTRINSIC
SPEC 2034 2131 1.83e0 SMART
coiled coil region 2173 2194 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
coiled coil region 2316 2348 N/A INTRINSIC
SPEC 2720 2820 1.44e-5 SMART
coiled coil region 2905 2934 N/A INTRINSIC
coiled coil region 2962 2989 N/A INTRINSIC
coiled coil region 3108 3136 N/A INTRINSIC
low complexity region 3333 3350 N/A INTRINSIC
low complexity region 3514 3523 N/A INTRINSIC
low complexity region 3666 3676 N/A INTRINSIC
coiled coil region 3678 3708 N/A INTRINSIC
coiled coil region 3761 3788 N/A INTRINSIC
coiled coil region 3846 3903 N/A INTRINSIC
coiled coil region 4015 4067 N/A INTRINSIC
low complexity region 4102 4115 N/A INTRINSIC
coiled coil region 4483 4511 N/A INTRINSIC
low complexity region 4557 4569 N/A INTRINSIC
coiled coil region 4655 4688 N/A INTRINSIC
low complexity region 4749 4763 N/A INTRINSIC
SPEC 4827 4926 5.25e-1 SMART
SPEC 4933 5038 2.64e-4 SMART
SPEC 5048 5152 1.47e-2 SMART
SPEC 5159 5259 4.29e0 SMART
SPEC 5263 5371 4.47e0 SMART
low complexity region 5373 5393 N/A INTRINSIC
SPEC 5583 5681 5.7e-1 SMART
Blast:SPEC 5690 5793 2e-53 BLAST
SPEC 5800 5900 2.11e0 SMART
SPEC 5907 6005 6.91e-8 SMART
SPEC 6012 6119 4.45e-11 SMART
SPEC 6126 6228 6.39e-12 SMART
SPEC 6235 6335 7.75e-11 SMART
SPEC 6539 6642 5.53e-7 SMART
SPEC 6649 6753 5.12e-2 SMART
KASH 6817 6874 8.17e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143031
AA Change: I3475V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119120
Gene: ENSMUSG00000063450
AA Change: I3475V

DomainStartEndE-ValueType
CH 33 134 7.97e-19 SMART
low complexity region 151 175 N/A INTRINSIC
CH 185 283 1.34e-20 SMART
low complexity region 494 505 N/A INTRINSIC
coiled coil region 541 572 N/A INTRINSIC
coiled coil region 845 870 N/A INTRINSIC
coiled coil region 937 970 N/A INTRINSIC
coiled coil region 1007 1033 N/A INTRINSIC
SPEC 1428 1526 4.96e0 SMART
SPEC 1529 1633 2.48e-1 SMART
coiled coil region 1661 1700 N/A INTRINSIC
SPEC 2035 2132 1.83e0 SMART
coiled coil region 2174 2195 N/A INTRINSIC
low complexity region 2296 2308 N/A INTRINSIC
coiled coil region 2317 2349 N/A INTRINSIC
SPEC 2721 2821 1.44e-5 SMART
coiled coil region 2906 2935 N/A INTRINSIC
coiled coil region 2963 2990 N/A INTRINSIC
coiled coil region 3109 3137 N/A INTRINSIC
low complexity region 3334 3351 N/A INTRINSIC
low complexity region 3515 3524 N/A INTRINSIC
low complexity region 3667 3677 N/A INTRINSIC
coiled coil region 3679 3709 N/A INTRINSIC
coiled coil region 3762 3789 N/A INTRINSIC
coiled coil region 3847 3904 N/A INTRINSIC
coiled coil region 4016 4068 N/A INTRINSIC
low complexity region 4103 4116 N/A INTRINSIC
coiled coil region 4484 4512 N/A INTRINSIC
low complexity region 4558 4570 N/A INTRINSIC
coiled coil region 4656 4689 N/A INTRINSIC
low complexity region 4750 4764 N/A INTRINSIC
SPEC 4828 4927 5.25e-1 SMART
SPEC 4934 5039 2.64e-4 SMART
SPEC 5049 5153 1.47e-2 SMART
SPEC 5160 5260 4.29e0 SMART
SPEC 5264 5372 4.47e0 SMART
low complexity region 5374 5394 N/A INTRINSIC
SPEC 5584 5682 5.7e-1 SMART
Blast:SPEC 5691 5794 2e-53 BLAST
SPEC 5801 5901 2.11e0 SMART
SPEC 5908 6006 6.91e-8 SMART
SPEC 6013 6120 4.45e-11 SMART
SPEC 6127 6229 6.39e-12 SMART
SPEC 6236 6336 7.75e-11 SMART
SPEC 6540 6643 5.53e-7 SMART
SPEC 6650 6754 5.12e-2 SMART
KASH 6813 6870 8.17e-34 SMART
Meta Mutation Damage Score 0.1314 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear outer membrane protein that binds cytoplasmic F-actin. This binding tethers the nucleus to the cytoskeleton and aids in the maintenance of the structural integrity of the nucleus. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for one knock-out allele show normal myonuclear positioning of both synaptic and non-synaptic nuclei in skeletal muscle cells. Homozygotes for another knock-out allele exhibit a thickened epidermis and altered nuclear envelope architecture inprimary dermal fibroblasts and keratinocytes. Mice homozygous for a spontaneous mutation exhibit early retinal defects in photoreceptors, secondary Neurons, and muller glia. [provided by MGI curators]
Allele List at MGI

 All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox1 A T 11: 116,066,152 (GRCm39) S453T probably benign Het
Ahnak2 A T 12: 112,740,550 (GRCm39) V368D probably damaging Het
Ankrd53 A T 6: 83,745,134 (GRCm39) Y448F probably damaging Het
Arhgef15 A T 11: 68,840,751 (GRCm39) probably benign Het
Atg2b T C 12: 105,613,073 (GRCm39) N1166S probably benign Het
Atl3 C T 19: 7,486,910 (GRCm39) R77* probably null Het
Bend6 T C 1: 33,922,654 (GRCm39) probably benign Het
Ccnt1 C A 15: 98,465,444 (GRCm39) R25L probably damaging Het
Cct4 A G 11: 22,952,898 (GRCm39) T525A probably benign Het
Cep350 T C 1: 155,804,579 (GRCm39) I835V probably damaging Het
Cimap2 T A 4: 106,467,724 (GRCm39) probably null Het
Clcn1 G T 6: 42,286,898 (GRCm39) V652L probably damaging Het
Cntln T A 4: 84,967,957 (GRCm39) Y725* probably null Het
Cog5 T C 12: 31,969,732 (GRCm39) F21L probably benign Het
D6Ertd527e GGCAGCAGCAGCA GGCAGCAGCAGCAGCA 6: 87,088,406 (GRCm39) probably benign Het
Dnm2 A T 9: 21,402,626 (GRCm39) probably benign Het
Dnmt1 C T 9: 20,819,854 (GRCm39) V1430I probably damaging Het
Dpep1 A G 8: 123,927,106 (GRCm39) D285G probably damaging Het
Eef2kmt C T 16: 5,066,867 (GRCm39) V129M probably damaging Het
Epha3 A T 16: 63,403,920 (GRCm39) M726K probably damaging Het
Fat3 A G 9: 16,289,019 (GRCm39) L168P probably damaging Het
Frem3 T A 8: 81,390,026 (GRCm39) F1759Y probably damaging Het
Fubp3 T A 2: 31,498,153 (GRCm39) S56R possibly damaging Het
Gm1965 T C 6: 89,122,392 (GRCm39) noncoding transcript Het
Gm5592 C T 7: 40,864,958 (GRCm39) probably benign Het
H1f9 T A 11: 94,858,843 (GRCm39) L46* probably null Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,265,453 (GRCm39) 913 probably null Het
Isl1 A G 13: 116,439,619 (GRCm39) M243T probably benign Het
Itpr1 A T 6: 108,366,498 (GRCm39) I142F probably damaging Het
Jak1 T C 4: 101,012,263 (GRCm39) T1069A probably damaging Het
Jmjd1c T C 10: 67,069,225 (GRCm39) V1848A probably benign Het
Kdm5a T C 6: 120,389,363 (GRCm39) V930A probably damaging Het
Kdm5b C A 1: 134,521,053 (GRCm39) probably null Het
Lilra5 T C 7: 4,241,713 (GRCm39) F171L possibly damaging Het
Map1b A G 13: 99,567,562 (GRCm39) S1720P unknown Het
Mcpt1 A T 14: 56,257,017 (GRCm39) Q185L probably damaging Het
Mmp20 T A 9: 7,644,027 (GRCm39) D238E possibly damaging Het
Mov10l1 A T 15: 88,904,472 (GRCm39) I784F possibly damaging Het
Mroh2b C T 15: 4,933,752 (GRCm39) P101S probably damaging Het
Myh3 G T 11: 66,987,765 (GRCm39) A1413S probably benign Het
Naa80 A T 9: 107,460,738 (GRCm39) Y211F probably damaging Het
Npdc1 G A 2: 25,298,957 (GRCm39) D284N probably damaging Het
Or12j4 A G 7: 140,046,989 (GRCm39) R292G probably damaging Het
Or2t48 A C 11: 58,420,308 (GRCm39) M168R probably damaging Het
Or4a66 A G 2: 88,531,544 (GRCm39) I43T probably damaging Het
Or5g9 A G 2: 85,551,793 (GRCm39) I15V probably benign Het
Or8k22 A T 2: 86,163,571 (GRCm39) M43K probably benign Het
Or8k23 G A 2: 86,186,094 (GRCm39) L211F probably benign Het
Palld T A 8: 62,140,415 (GRCm39) T531S probably benign Het
Parp4 A G 14: 56,823,195 (GRCm39) E105G probably benign Het
Phf11a A T 14: 59,525,028 (GRCm39) S59T probably damaging Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Rad50 A T 11: 53,541,480 (GRCm39) I1252N probably damaging Het
Ramp3 A G 11: 6,624,761 (GRCm39) probably null Het
Rrbp1 G A 2: 143,830,337 (GRCm39) T610I possibly damaging Het
Scart2 T C 7: 139,879,021 (GRCm39) I1051T probably benign Het
Semp2l2a C T 8: 13,888,007 (GRCm39) S28N probably benign Het
Slc4a10 A G 2: 62,098,531 (GRCm39) Y555C probably damaging Het
Slc5a2 A G 7: 127,866,677 (GRCm39) probably null Het
Smoc1 T A 12: 81,226,322 (GRCm39) D371E probably damaging Het
Stmn1 T A 4: 134,197,495 (GRCm39) probably benign Het
Sulf1 C T 1: 12,912,910 (GRCm39) L715F probably benign Het
Surf1 T C 2: 26,804,255 (GRCm39) T180A possibly damaging Het
Tchh A T 3: 93,352,455 (GRCm39) R632W unknown Het
Tchh A T 3: 93,354,895 (GRCm39) D1445V unknown Het
Tctn1 A T 5: 122,383,568 (GRCm39) M505K probably benign Het
Tdrkh T A 3: 94,332,897 (GRCm39) I150N probably damaging Het
Tespa1 C T 10: 130,198,028 (GRCm39) T350I probably benign Het
Thbs1 A G 2: 117,945,499 (GRCm39) Y326C possibly damaging Het
Tmem208 C T 8: 106,055,296 (GRCm39) S119F probably damaging Het
Tmprss6 G C 15: 78,329,588 (GRCm39) A91G probably damaging Het
Trp53bp2 C T 1: 182,259,147 (GRCm39) R67W probably damaging Het
Ttn A G 2: 76,541,541 (GRCm39) I25488T possibly damaging Het
Txnl4a A G 18: 80,265,468 (GRCm39) E111G probably damaging Het
Unc13b T G 4: 43,237,137 (GRCm39) I3402M probably damaging Het
Vmn1r188 A C 13: 22,272,291 (GRCm39) I82L probably benign Het
Zfp65 A G 13: 67,856,994 (GRCm39) V95A probably benign Het
Zfp985 T A 4: 147,668,612 (GRCm39) S493R probably damaging Het
Other mutations in Syne2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Syne2 APN 12 76,078,474 (GRCm39) unclassified probably benign
IGL00595:Syne2 APN 12 75,972,420 (GRCm39) missense possibly damaging 0.76
IGL00672:Syne2 APN 12 76,110,958 (GRCm39) missense probably damaging 1.00
IGL00781:Syne2 APN 12 76,070,836 (GRCm39) missense probably benign 0.00
IGL00823:Syne2 APN 12 76,036,016 (GRCm39) missense probably damaging 0.98
IGL01014:Syne2 APN 12 75,952,051 (GRCm39) missense probably damaging 0.99
IGL01074:Syne2 APN 12 76,078,361 (GRCm39) nonsense probably null
IGL01074:Syne2 APN 12 76,033,785 (GRCm39) missense probably benign 0.00
IGL01324:Syne2 APN 12 76,090,526 (GRCm39) missense probably damaging 1.00
IGL01325:Syne2 APN 12 75,973,288 (GRCm39) missense probably benign 0.01
IGL01331:Syne2 APN 12 75,976,027 (GRCm39) splice site probably benign
IGL01338:Syne2 APN 12 76,107,000 (GRCm39) missense possibly damaging 0.55
IGL01373:Syne2 APN 12 76,033,881 (GRCm39) missense probably damaging 1.00
IGL01446:Syne2 APN 12 76,088,149 (GRCm39) missense probably damaging 1.00
IGL01556:Syne2 APN 12 76,134,589 (GRCm39) missense probably damaging 1.00
IGL01585:Syne2 APN 12 75,995,834 (GRCm39) critical splice acceptor site probably null
IGL01629:Syne2 APN 12 76,051,377 (GRCm39) missense possibly damaging 0.49
IGL01686:Syne2 APN 12 75,956,110 (GRCm39) missense probably benign
IGL01935:Syne2 APN 12 75,972,087 (GRCm39) missense probably damaging 1.00
IGL01941:Syne2 APN 12 76,013,994 (GRCm39) missense probably benign 0.01
IGL01956:Syne2 APN 12 76,144,748 (GRCm39) missense probably damaging 1.00
IGL01967:Syne2 APN 12 75,988,077 (GRCm39) missense probably damaging 1.00
IGL01990:Syne2 APN 12 76,101,707 (GRCm39) missense probably damaging 1.00
IGL02000:Syne2 APN 12 76,062,419 (GRCm39) missense probably damaging 0.99
IGL02063:Syne2 APN 12 76,098,874 (GRCm39) missense probably damaging 0.96
IGL02069:Syne2 APN 12 75,974,186 (GRCm39) missense probably benign 0.13
IGL02120:Syne2 APN 12 75,993,480 (GRCm39) missense probably damaging 1.00
IGL02222:Syne2 APN 12 75,999,617 (GRCm39) missense probably damaging 0.96
IGL02223:Syne2 APN 12 76,155,079 (GRCm39) missense probably benign 0.00
IGL02321:Syne2 APN 12 75,965,773 (GRCm39) missense possibly damaging 0.58
IGL02488:Syne2 APN 12 76,012,512 (GRCm39) missense probably benign 0.24
IGL02491:Syne2 APN 12 76,118,953 (GRCm39) missense probably benign 0.10
IGL02525:Syne2 APN 12 76,147,777 (GRCm39) missense probably damaging 0.99
IGL02578:Syne2 APN 12 76,069,053 (GRCm39) missense possibly damaging 0.76
IGL02615:Syne2 APN 12 76,143,768 (GRCm39) missense probably damaging 1.00
IGL02702:Syne2 APN 12 76,144,698 (GRCm39) missense probably damaging 1.00
IGL02726:Syne2 APN 12 76,062,356 (GRCm39) missense probably damaging 0.99
IGL02795:Syne2 APN 12 76,013,323 (GRCm39) missense probably damaging 0.99
IGL02803:Syne2 APN 12 76,078,320 (GRCm39) missense probably damaging 1.00
IGL02814:Syne2 APN 12 75,992,150 (GRCm39) missense possibly damaging 0.64
IGL03013:Syne2 APN 12 75,976,111 (GRCm39) missense probably benign 0.00
IGL03131:Syne2 APN 12 76,104,264 (GRCm39) missense probably damaging 1.00
IGL03152:Syne2 APN 12 76,012,486 (GRCm39) missense probably benign 0.12
IGL03216:Syne2 APN 12 75,989,735 (GRCm39) splice site probably benign
IGL03228:Syne2 APN 12 76,026,686 (GRCm39) missense probably benign 0.01
IGL03259:Syne2 APN 12 76,035,853 (GRCm39) missense probably benign 0.05
IGL03374:Syne2 APN 12 76,121,360 (GRCm39) missense possibly damaging 0.66
IGL03375:Syne2 APN 12 75,972,209 (GRCm39) missense possibly damaging 0.57
3-1:Syne2 UTSW 12 75,977,406 (GRCm39) missense probably benign 0.02
B5639:Syne2 UTSW 12 75,976,564 (GRCm39) missense probably benign
K3955:Syne2 UTSW 12 75,977,439 (GRCm39) missense probably damaging 1.00
P0026:Syne2 UTSW 12 75,926,994 (GRCm39) splice site probably benign
PIT4514001:Syne2 UTSW 12 76,151,789 (GRCm39) missense probably damaging 0.99
R0089:Syne2 UTSW 12 76,010,650 (GRCm39) missense probably damaging 1.00
R0110:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0113:Syne2 UTSW 12 76,080,496 (GRCm39) missense probably damaging 1.00
R0113:Syne2 UTSW 12 75,977,352 (GRCm39) missense probably damaging 1.00
R0141:Syne2 UTSW 12 75,988,072 (GRCm39) missense probably damaging 1.00
R0211:Syne2 UTSW 12 76,144,731 (GRCm39) missense probably damaging 1.00
R0219:Syne2 UTSW 12 76,088,778 (GRCm39) missense probably damaging 1.00
R0242:Syne2 UTSW 12 76,144,808 (GRCm39) missense probably damaging 1.00
R0242:Syne2 UTSW 12 76,144,808 (GRCm39) missense probably damaging 1.00
R0279:Syne2 UTSW 12 76,142,387 (GRCm39) missense probably damaging 1.00
R0319:Syne2 UTSW 12 76,110,936 (GRCm39) missense probably damaging 0.99
R0325:Syne2 UTSW 12 76,009,415 (GRCm39) missense probably benign 0.00
R0329:Syne2 UTSW 12 76,013,727 (GRCm39) missense probably benign
R0330:Syne2 UTSW 12 76,013,727 (GRCm39) missense probably benign
R0361:Syne2 UTSW 12 75,965,384 (GRCm39) missense probably benign 0.22
R0363:Syne2 UTSW 12 76,118,981 (GRCm39) missense probably damaging 0.98
R0367:Syne2 UTSW 12 75,926,951 (GRCm39) missense probably damaging 1.00
R0371:Syne2 UTSW 12 75,980,619 (GRCm39) missense probably damaging 1.00
R0374:Syne2 UTSW 12 75,968,000 (GRCm39) nonsense probably null
R0388:Syne2 UTSW 12 76,033,749 (GRCm39) missense probably benign 0.41
R0411:Syne2 UTSW 12 76,106,358 (GRCm39) splice site probably null
R0432:Syne2 UTSW 12 75,995,838 (GRCm39) missense probably damaging 0.99
R0469:Syne2 UTSW 12 75,900,923 (GRCm39) critical splice donor site probably null
R0492:Syne2 UTSW 12 76,028,837 (GRCm39) critical splice donor site probably null
R0496:Syne2 UTSW 12 76,085,714 (GRCm39) missense possibly damaging 0.80
R0504:Syne2 UTSW 12 76,080,365 (GRCm39) splice site probably benign
R0505:Syne2 UTSW 12 76,146,238 (GRCm39) missense probably damaging 1.00
R0510:Syne2 UTSW 12 75,900,923 (GRCm39) critical splice donor site probably null
R0518:Syne2 UTSW 12 76,155,636 (GRCm39) critical splice acceptor site probably null
R0539:Syne2 UTSW 12 76,070,895 (GRCm39) missense possibly damaging 0.69
R0552:Syne2 UTSW 12 75,977,778 (GRCm39) missense probably benign 0.00
R0557:Syne2 UTSW 12 75,976,075 (GRCm39) missense probably benign 0.04
R0567:Syne2 UTSW 12 75,937,004 (GRCm39) missense probably damaging 0.98
R0599:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0602:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0608:Syne2 UTSW 12 76,010,587 (GRCm39) missense probably damaging 1.00
R0614:Syne2 UTSW 12 75,959,127 (GRCm39) splice site probably null
R0636:Syne2 UTSW 12 75,977,757 (GRCm39) missense possibly damaging 0.75
R0647:Syne2 UTSW 12 75,934,977 (GRCm39) missense probably benign
R0654:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0658:Syne2 UTSW 12 76,141,110 (GRCm39) missense probably damaging 1.00
R0666:Syne2 UTSW 12 75,969,787 (GRCm39) missense probably damaging 0.99
R0707:Syne2 UTSW 12 76,028,837 (GRCm39) critical splice donor site probably null
R0714:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0841:Syne2 UTSW 12 76,121,209 (GRCm39) splice site probably benign
R0848:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0848:Syne2 UTSW 12 76,144,733 (GRCm39) frame shift probably null
R1077:Syne2 UTSW 12 76,088,809 (GRCm39) missense possibly damaging 0.94
R1103:Syne2 UTSW 12 76,156,609 (GRCm39) missense probably benign 0.00
R1144:Syne2 UTSW 12 76,013,298 (GRCm39) missense probably benign 0.04
R1194:Syne2 UTSW 12 75,981,287 (GRCm39) missense probably damaging 1.00
R1247:Syne2 UTSW 12 76,014,264 (GRCm39) missense probably benign 0.39
R1276:Syne2 UTSW 12 75,987,963 (GRCm39) critical splice acceptor site probably null
R1343:Syne2 UTSW 12 76,080,417 (GRCm39) missense probably damaging 1.00
R1442:Syne2 UTSW 12 75,993,489 (GRCm39) missense probably damaging 1.00
R1448:Syne2 UTSW 12 76,098,952 (GRCm39) missense possibly damaging 0.56
R1448:Syne2 UTSW 12 76,067,099 (GRCm39) splice site probably null
R1522:Syne2 UTSW 12 76,150,557 (GRCm39) missense probably damaging 0.98
R1528:Syne2 UTSW 12 76,012,874 (GRCm39) missense probably benign 0.00
R1636:Syne2 UTSW 12 76,051,506 (GRCm39) missense probably benign 0.01
R1637:Syne2 UTSW 12 76,042,776 (GRCm39) missense probably damaging 1.00
R1650:Syne2 UTSW 12 75,951,033 (GRCm39) nonsense probably null
R1654:Syne2 UTSW 12 76,147,868 (GRCm39) missense possibly damaging 0.56
R1714:Syne2 UTSW 12 76,101,713 (GRCm39) missense probably benign 0.26
R1750:Syne2 UTSW 12 76,099,579 (GRCm39) missense probably damaging 1.00
R1772:Syne2 UTSW 12 75,985,503 (GRCm39) missense probably benign 0.19
R1797:Syne2 UTSW 12 76,010,557 (GRCm39) missense probably benign 0.00
R1830:Syne2 UTSW 12 76,156,636 (GRCm39) missense probably damaging 1.00
R1837:Syne2 UTSW 12 76,014,434 (GRCm39) missense probably damaging 0.99
R1908:Syne2 UTSW 12 76,141,053 (GRCm39) critical splice acceptor site probably null
R1913:Syne2 UTSW 12 75,946,020 (GRCm39) missense possibly damaging 0.60
R1944:Syne2 UTSW 12 76,121,318 (GRCm39) missense probably damaging 1.00
R1950:Syne2 UTSW 12 75,999,644 (GRCm39) missense probably benign
R1958:Syne2 UTSW 12 76,016,319 (GRCm39) missense probably benign 0.11
R2018:Syne2 UTSW 12 76,121,353 (GRCm39) missense probably damaging 1.00
R2037:Syne2 UTSW 12 76,072,343 (GRCm39) missense probably benign 0.04
R2067:Syne2 UTSW 12 75,935,116 (GRCm39) critical splice donor site probably null
R2073:Syne2 UTSW 12 76,062,353 (GRCm39) missense possibly damaging 0.54
R2099:Syne2 UTSW 12 76,026,747 (GRCm39) missense probably benign 0.06
R2102:Syne2 UTSW 12 76,074,853 (GRCm39) missense probably benign 0.01
R2134:Syne2 UTSW 12 75,999,560 (GRCm39) missense probably damaging 0.99
R2135:Syne2 UTSW 12 75,999,560 (GRCm39) missense probably damaging 0.99
R2157:Syne2 UTSW 12 76,141,230 (GRCm39) missense probably damaging 1.00
R2173:Syne2 UTSW 12 76,147,763 (GRCm39) splice site probably benign
R2248:Syne2 UTSW 12 76,143,678 (GRCm39) missense probably damaging 1.00
R2276:Syne2 UTSW 12 75,974,240 (GRCm39) missense possibly damaging 0.87
R2277:Syne2 UTSW 12 75,974,240 (GRCm39) missense possibly damaging 0.87
R2278:Syne2 UTSW 12 75,974,240 (GRCm39) missense possibly damaging 0.87
R2279:Syne2 UTSW 12 75,974,240 (GRCm39) missense possibly damaging 0.87
R2483:Syne2 UTSW 12 76,142,311 (GRCm39) missense probably damaging 1.00
R2877:Syne2 UTSW 12 76,047,605 (GRCm39) missense probably benign 0.00
R2884:Syne2 UTSW 12 76,010,533 (GRCm39) missense probably benign 0.00
R3119:Syne2 UTSW 12 75,956,058 (GRCm39) missense probably benign 0.01
R3499:Syne2 UTSW 12 76,101,752 (GRCm39) splice site probably null
R3827:Syne2 UTSW 12 76,033,805 (GRCm39) missense probably benign 0.02
R3847:Syne2 UTSW 12 76,095,396 (GRCm39) missense probably damaging 1.00
R3849:Syne2 UTSW 12 76,092,839 (GRCm39) nonsense probably null
R3850:Syne2 UTSW 12 76,095,396 (GRCm39) missense probably damaging 1.00
R3859:Syne2 UTSW 12 75,976,558 (GRCm39) missense possibly damaging 0.55
R3861:Syne2 UTSW 12 76,013,253 (GRCm39) missense probably damaging 0.98
R4078:Syne2 UTSW 12 76,082,398 (GRCm39) missense probably damaging 1.00
R4116:Syne2 UTSW 12 75,977,853 (GRCm39) missense probably damaging 1.00
R4326:Syne2 UTSW 12 75,999,516 (GRCm39) missense probably damaging 1.00
R4335:Syne2 UTSW 12 76,074,866 (GRCm39) missense probably damaging 1.00
R4410:Syne2 UTSW 12 76,141,167 (GRCm39) missense probably damaging 1.00
R4412:Syne2 UTSW 12 76,152,834 (GRCm39) missense probably benign 0.01
R4444:Syne2 UTSW 12 76,069,804 (GRCm39) missense probably damaging 1.00
R4595:Syne2 UTSW 12 76,013,845 (GRCm39) missense possibly damaging 0.88
R4604:Syne2 UTSW 12 76,014,484 (GRCm39) missense probably damaging 0.99
R4606:Syne2 UTSW 12 76,036,027 (GRCm39) missense probably damaging 1.00
R4651:Syne2 UTSW 12 76,036,013 (GRCm39) missense probably damaging 0.99
R4656:Syne2 UTSW 12 76,078,147 (GRCm39) missense probably damaging 1.00
R4675:Syne2 UTSW 12 75,996,075 (GRCm39) missense probably damaging 1.00
R4790:Syne2 UTSW 12 76,067,165 (GRCm39) missense probably benign 0.19
R4791:Syne2 UTSW 12 75,956,018 (GRCm39) missense possibly damaging 0.96
R4799:Syne2 UTSW 12 75,945,941 (GRCm39) missense probably benign 0.04
R4880:Syne2 UTSW 12 76,026,593 (GRCm39) missense probably damaging 1.00
R4881:Syne2 UTSW 12 76,026,593 (GRCm39) missense probably damaging 1.00
R4899:Syne2 UTSW 12 75,900,875 (GRCm39) missense probably benign 0.03
R4934:Syne2 UTSW 12 75,946,046 (GRCm39) missense probably benign 0.14
R4981:Syne2 UTSW 12 75,987,993 (GRCm39) missense probably damaging 0.98
R4996:Syne2 UTSW 12 75,990,724 (GRCm39) missense possibly damaging 0.87
R5056:Syne2 UTSW 12 75,955,905 (GRCm39) unclassified probably benign
R5066:Syne2 UTSW 12 76,013,325 (GRCm39) missense probably benign 0.05
R5095:Syne2 UTSW 12 75,999,600 (GRCm39) missense probably damaging 0.99
R5151:Syne2 UTSW 12 76,090,484 (GRCm39) missense probably benign 0.06
R5193:Syne2 UTSW 12 76,141,194 (GRCm39) missense probably damaging 1.00
R5267:Syne2 UTSW 12 75,985,515 (GRCm39) missense possibly damaging 0.74
R5288:Syne2 UTSW 12 76,146,112 (GRCm39) missense possibly damaging 0.94
R5402:Syne2 UTSW 12 76,106,213 (GRCm39) missense probably damaging 0.98
R5434:Syne2 UTSW 12 76,018,649 (GRCm39) missense probably damaging 1.00
R5441:Syne2 UTSW 12 76,035,917 (GRCm39) missense possibly damaging 0.75
R5488:Syne2 UTSW 12 75,934,946 (GRCm39) missense probably benign 0.13
R5497:Syne2 UTSW 12 75,927,163 (GRCm39) missense probably benign 0.19
R5506:Syne2 UTSW 12 75,985,495 (GRCm39) missense probably benign 0.01
R5509:Syne2 UTSW 12 75,968,018 (GRCm39) missense probably damaging 1.00
R5518:Syne2 UTSW 12 75,991,944 (GRCm39) missense possibly damaging 0.88
R5561:Syne2 UTSW 12 76,141,232 (GRCm39) nonsense probably null
R5581:Syne2 UTSW 12 75,991,859 (GRCm39) missense probably benign 0.01
R5625:Syne2 UTSW 12 76,141,886 (GRCm39) missense probably benign 0.06
R5642:Syne2 UTSW 12 75,965,306 (GRCm39) missense probably damaging 1.00
R5665:Syne2 UTSW 12 76,154,991 (GRCm39) critical splice donor site probably null
R5666:Syne2 UTSW 12 75,997,733 (GRCm39) missense probably benign 0.16
R5670:Syne2 UTSW 12 75,997,733 (GRCm39) missense probably benign 0.16
R5691:Syne2 UTSW 12 76,074,630 (GRCm39) frame shift probably null
R5696:Syne2 UTSW 12 76,040,919 (GRCm39) missense probably benign 0.00
R5720:Syne2 UTSW 12 76,014,441 (GRCm39) missense probably benign 0.03
R5739:Syne2 UTSW 12 76,044,239 (GRCm39) missense possibly damaging 0.53
R5840:Syne2 UTSW 12 75,927,065 (GRCm39) splice site probably null
R5846:Syne2 UTSW 12 76,074,898 (GRCm39) missense probably benign 0.01
R5850:Syne2 UTSW 12 76,144,749 (GRCm39) missense probably damaging 1.00
R5889:Syne2 UTSW 12 76,119,026 (GRCm39) nonsense probably null
R5912:Syne2 UTSW 12 75,955,721 (GRCm39) critical splice donor site probably null
R5931:Syne2 UTSW 12 76,055,639 (GRCm39) missense probably benign 0.37
R5985:Syne2 UTSW 12 76,012,933 (GRCm39) missense probably damaging 0.96
R5988:Syne2 UTSW 12 75,976,191 (GRCm39) critical splice donor site probably null
R5990:Syne2 UTSW 12 76,070,918 (GRCm39) missense probably benign 0.10
R6038:Syne2 UTSW 12 75,925,158 (GRCm39) nonsense probably null
R6038:Syne2 UTSW 12 75,925,158 (GRCm39) nonsense probably null
R6132:Syne2 UTSW 12 75,991,921 (GRCm39) missense probably benign 0.14
R6136:Syne2 UTSW 12 75,952,099 (GRCm39) missense probably benign 0.24
R6229:Syne2 UTSW 12 75,967,994 (GRCm39) missense probably benign 0.00
R6252:Syne2 UTSW 12 76,016,210 (GRCm39) missense probably benign 0.39
R6271:Syne2 UTSW 12 75,937,155 (GRCm39) missense probably damaging 1.00
R6320:Syne2 UTSW 12 76,108,424 (GRCm39) missense probably damaging 0.96
R6339:Syne2 UTSW 12 76,035,927 (GRCm39) missense probably benign 0.34
R6380:Syne2 UTSW 12 76,151,754 (GRCm39) missense probably damaging 0.98
R6394:Syne2 UTSW 12 76,037,269 (GRCm39) missense probably benign 0.09
R6419:Syne2 UTSW 12 76,143,740 (GRCm39) missense probably damaging 1.00
R6426:Syne2 UTSW 12 75,969,857 (GRCm39) missense probably null 0.97
R6434:Syne2 UTSW 12 76,088,230 (GRCm39) missense probably damaging 0.99
R6437:Syne2 UTSW 12 76,037,188 (GRCm39) missense possibly damaging 0.87
R6466:Syne2 UTSW 12 75,990,675 (GRCm39) missense probably damaging 0.97
R6501:Syne2 UTSW 12 76,074,621 (GRCm39) splice site probably null
R6552:Syne2 UTSW 12 75,937,015 (GRCm39) missense possibly damaging 0.89
R6744:Syne2 UTSW 12 76,121,221 (GRCm39) missense probably damaging 1.00
R6810:Syne2 UTSW 12 75,989,659 (GRCm39) missense probably benign 0.00
R6831:Syne2 UTSW 12 76,013,568 (GRCm39) missense probably benign 0.39
R6861:Syne2 UTSW 12 75,956,040 (GRCm39) missense probably damaging 1.00
R6875:Syne2 UTSW 12 76,082,404 (GRCm39) missense probably damaging 0.99
R6892:Syne2 UTSW 12 76,009,302 (GRCm39) missense probably damaging 0.98
R6899:Syne2 UTSW 12 76,142,503 (GRCm39) splice site probably null
R6906:Syne2 UTSW 12 76,042,760 (GRCm39) missense possibly damaging 0.93
R6909:Syne2 UTSW 12 76,110,969 (GRCm39) missense probably benign 0.04
R6925:Syne2 UTSW 12 75,900,906 (GRCm39) missense possibly damaging 0.58
R6949:Syne2 UTSW 12 76,012,771 (GRCm39) missense probably benign 0.00
R6952:Syne2 UTSW 12 75,974,205 (GRCm39) missense possibly damaging 0.76
R6996:Syne2 UTSW 12 76,074,786 (GRCm39) missense probably damaging 0.99
R7080:Syne2 UTSW 12 76,099,501 (GRCm39) missense probably benign 0.00
R7083:Syne2 UTSW 12 75,990,662 (GRCm39) missense probably damaging 1.00
R7090:Syne2 UTSW 12 75,989,125 (GRCm39) missense probably benign
R7144:Syne2 UTSW 12 76,052,152 (GRCm39) missense probably benign 0.03
R7154:Syne2 UTSW 12 76,106,231 (GRCm39) missense possibly damaging 0.63
R7177:Syne2 UTSW 12 76,018,654 (GRCm39) nonsense probably null
R7190:Syne2 UTSW 12 76,113,361 (GRCm39) missense probably benign 0.01
R7206:Syne2 UTSW 12 76,051,531 (GRCm39) missense probably benign 0.02
R7208:Syne2 UTSW 12 76,078,172 (GRCm39) splice site probably null
R7230:Syne2 UTSW 12 75,980,674 (GRCm39) missense probably benign 0.12
R7260:Syne2 UTSW 12 75,991,853 (GRCm39) missense probably damaging 1.00
R7272:Syne2 UTSW 12 76,095,417 (GRCm39) missense probably benign 0.00
R7296:Syne2 UTSW 12 76,149,810 (GRCm39) missense probably benign 0.00
R7322:Syne2 UTSW 12 76,030,798 (GRCm39) missense probably damaging 1.00
R7329:Syne2 UTSW 12 76,013,758 (GRCm39) missense probably benign 0.01
R7332:Syne2 UTSW 12 76,014,529 (GRCm39) critical splice donor site probably null
R7381:Syne2 UTSW 12 75,973,263 (GRCm39) missense probably benign 0.11
R7401:Syne2 UTSW 12 76,014,155 (GRCm39) missense probably damaging 0.98
R7403:Syne2 UTSW 12 75,962,020 (GRCm39) missense not run
R7429:Syne2 UTSW 12 76,087,184 (GRCm39) nonsense probably null
R7429:Syne2 UTSW 12 75,980,770 (GRCm39) missense probably damaging 1.00
R7430:Syne2 UTSW 12 76,087,184 (GRCm39) nonsense probably null
R7430:Syne2 UTSW 12 75,980,770 (GRCm39) missense probably damaging 1.00
R7438:Syne2 UTSW 12 76,062,337 (GRCm39) missense probably benign 0.04
R7447:Syne2 UTSW 12 76,074,853 (GRCm39) missense probably benign 0.01
R7466:Syne2 UTSW 12 76,092,960 (GRCm39) missense possibly damaging 0.92
R7493:Syne2 UTSW 12 76,012,654 (GRCm39) missense probably benign 0.00
R7502:Syne2 UTSW 12 76,141,100 (GRCm39) missense probably damaging 1.00
R7543:Syne2 UTSW 12 75,953,616 (GRCm39) missense possibly damaging 0.93
R7569:Syne2 UTSW 12 75,974,164 (GRCm39) missense probably benign 0.00
R7599:Syne2 UTSW 12 76,013,145 (GRCm39) missense probably benign 0.04
R7618:Syne2 UTSW 12 75,992,108 (GRCm39) missense probably benign 0.01
R7639:Syne2 UTSW 12 75,981,273 (GRCm39) missense probably damaging 1.00
R7698:Syne2 UTSW 12 75,995,838 (GRCm39) missense probably damaging 0.99
R7702:Syne2 UTSW 12 76,037,161 (GRCm39) missense probably benign 0.16
R7737:Syne2 UTSW 12 75,989,622 (GRCm39) missense probably damaging 1.00
R7742:Syne2 UTSW 12 76,106,209 (GRCm39) missense probably benign 0.02
R7753:Syne2 UTSW 12 76,085,697 (GRCm39) missense probably benign 0.43
R7755:Syne2 UTSW 12 76,044,181 (GRCm39) missense probably benign 0.19
R7757:Syne2 UTSW 12 76,108,553 (GRCm39) missense possibly damaging 0.87
R7790:Syne2 UTSW 12 75,975,877 (GRCm39) splice site probably null
R7808:Syne2 UTSW 12 76,030,501 (GRCm39) splice site probably null
R7809:Syne2 UTSW 12 76,014,230 (GRCm39) missense probably benign 0.00
R7811:Syne2 UTSW 12 76,030,501 (GRCm39) splice site probably null
R7834:Syne2 UTSW 12 76,014,021 (GRCm39) missense probably benign 0.00
R7853:Syne2 UTSW 12 76,078,278 (GRCm39) missense probably damaging 1.00
R7867:Syne2 UTSW 12 76,030,501 (GRCm39) splice site probably null
R7896:Syne2 UTSW 12 76,082,397 (GRCm39) missense probably damaging 0.99
R7903:Syne2 UTSW 12 76,110,958 (GRCm39) missense probably damaging 1.00
R7944:Syne2 UTSW 12 75,951,079 (GRCm39) missense probably damaging 0.98
R7945:Syne2 UTSW 12 75,951,079 (GRCm39) missense probably damaging 0.98
R7963:Syne2 UTSW 12 76,067,174 (GRCm39) missense probably benign 0.38
R7996:Syne2 UTSW 12 76,051,441 (GRCm39) missense probably damaging 1.00
R7998:Syne2 UTSW 12 76,134,632 (GRCm39) missense probably damaging 1.00
R8010:Syne2 UTSW 12 75,977,512 (GRCm39) missense probably benign 0.39
R8016:Syne2 UTSW 12 75,989,681 (GRCm39) missense probably benign 0.19
R8140:Syne2 UTSW 12 75,959,127 (GRCm39) missense possibly damaging 0.63
R8141:Syne2 UTSW 12 76,108,442 (GRCm39) missense possibly damaging 0.66
R8206:Syne2 UTSW 12 76,062,365 (GRCm39) missense probably benign 0.03
R8258:Syne2 UTSW 12 75,996,143 (GRCm39) missense possibly damaging 0.95
R8259:Syne2 UTSW 12 75,996,143 (GRCm39) missense possibly damaging 0.95
R8320:Syne2 UTSW 12 76,150,604 (GRCm39) missense probably damaging 0.99
R8464:Syne2 UTSW 12 76,012,546 (GRCm39) missense probably benign 0.39
R8465:Syne2 UTSW 12 75,900,898 (GRCm39) missense possibly damaging 0.92
R8486:Syne2 UTSW 12 76,088,881 (GRCm39) nonsense probably null
R8488:Syne2 UTSW 12 76,012,546 (GRCm39) missense probably benign 0.39
R8511:Syne2 UTSW 12 76,055,647 (GRCm39) missense probably benign 0.03
R8540:Syne2 UTSW 12 76,141,148 (GRCm39) missense probably damaging 1.00
R8711:Syne2 UTSW 12 76,104,258 (GRCm39) missense probably damaging 1.00
R8722:Syne2 UTSW 12 75,972,095 (GRCm39) missense probably benign 0.04
R8827:Syne2 UTSW 12 76,095,357 (GRCm39) missense probably benign 0.00
R8867:Syne2 UTSW 12 75,989,620 (GRCm39) missense probably damaging 1.00
R8878:Syne2 UTSW 12 75,952,067 (GRCm39) missense probably benign
R8924:Syne2 UTSW 12 75,943,444 (GRCm39) missense probably damaging 0.97
R8966:Syne2 UTSW 12 76,146,197 (GRCm39) missense probably damaging 1.00
R9007:Syne2 UTSW 12 76,146,224 (GRCm39) missense possibly damaging 0.82
R9019:Syne2 UTSW 12 75,999,618 (GRCm39) missense possibly damaging 0.93
R9057:Syne2 UTSW 12 75,937,167 (GRCm39) missense probably damaging 1.00
R9067:Syne2 UTSW 12 75,950,994 (GRCm39) missense probably damaging 1.00
R9081:Syne2 UTSW 12 76,016,290 (GRCm39) nonsense probably null
R9091:Syne2 UTSW 12 75,977,834 (GRCm39) missense probably damaging 1.00
R9123:Syne2 UTSW 12 76,040,838 (GRCm39) missense probably damaging 1.00
R9147:Syne2 UTSW 12 75,937,158 (GRCm39) missense probably damaging 1.00
R9148:Syne2 UTSW 12 75,937,158 (GRCm39) missense probably damaging 1.00
R9163:Syne2 UTSW 12 76,009,349 (GRCm39) missense possibly damaging 0.88
R9192:Syne2 UTSW 12 76,156,703 (GRCm39) missense probably damaging 1.00
R9248:Syne2 UTSW 12 76,154,230 (GRCm39) intron probably benign
R9270:Syne2 UTSW 12 75,977,834 (GRCm39) missense probably damaging 1.00
R9292:Syne2 UTSW 12 75,997,823 (GRCm39) missense probably benign
R9397:Syne2 UTSW 12 76,040,849 (GRCm39) missense possibly damaging 0.59
R9454:Syne2 UTSW 12 76,141,844 (GRCm39) nonsense probably null
R9454:Syne2 UTSW 12 76,067,275 (GRCm39) missense probably damaging 0.99
R9478:Syne2 UTSW 12 76,154,387 (GRCm39) missense probably damaging 0.96
R9492:Syne2 UTSW 12 75,995,839 (GRCm39) missense possibly damaging 0.77
R9573:Syne2 UTSW 12 75,927,134 (GRCm39) missense probably damaging 1.00
R9611:Syne2 UTSW 12 76,080,460 (GRCm39) missense probably benign 0.05
R9623:Syne2 UTSW 12 75,986,760 (GRCm39) missense probably benign 0.12
R9647:Syne2 UTSW 12 76,151,875 (GRCm39) missense possibly damaging 0.55
R9652:Syne2 UTSW 12 76,101,620 (GRCm39) missense probably benign 0.00
R9667:Syne2 UTSW 12 75,926,951 (GRCm39) missense probably damaging 1.00
R9701:Syne2 UTSW 12 76,037,197 (GRCm39) missense probably damaging 1.00
R9794:Syne2 UTSW 12 76,047,617 (GRCm39) missense probably benign 0.04
R9802:Syne2 UTSW 12 76,037,197 (GRCm39) missense probably damaging 1.00
X0019:Syne2 UTSW 12 76,020,061 (GRCm39) missense probably benign 0.41
X0026:Syne2 UTSW 12 76,147,790 (GRCm39) missense possibly damaging 0.78
X0061:Syne2 UTSW 12 75,974,285 (GRCm39) critical splice donor site probably null
X0066:Syne2 UTSW 12 76,143,701 (GRCm39) missense probably damaging 1.00
Z1176:Syne2 UTSW 12 76,087,157 (GRCm39) missense possibly damaging 0.48
Z1176:Syne2 UTSW 12 76,014,315 (GRCm39) missense probably benign 0.01
Z1177:Syne2 UTSW 12 76,020,197 (GRCm39) missense probably damaging 1.00
Z1177:Syne2 UTSW 12 76,144,748 (GRCm39) missense probably damaging 1.00
Z1177:Syne2 UTSW 12 76,110,912 (GRCm39) missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TTCACAATAGCATTTCCTCATCGG -3'
(R):5'- TGGATACTCCTGACACGCTG -3'

Sequencing Primer
(F):5'- GAGCTACGCGATCCTTGATCAC -3'
(R):5'- GATACTCCTGACACGCTGTAGAAG -3'
Posted On 2016-03-01